Incidental Mutation 'PIT4142001:Kndc1'
ID 486932
Institutional Source Beutler Lab
Gene Symbol Kndc1
Ensembl Gene ENSMUSG00000066129
Gene Name kinase non-catalytic C-lobe domain (KIND) containing 1
Synonyms B830014K08Rik, VKIND, very-kind, 2410012C07Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # PIT4142001 (G1)
Quality Score 101.457
Status Not validated
Chromosome 7
Chromosomal Location 139474612-139521450 bp(+) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) TC to T at 139503692 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000050586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053445]
AlphaFold Q0KK55
Predicted Effect probably null
Transcript: ENSMUST00000053445
SMART Domains Protein: ENSMUSP00000050586
Gene: ENSMUSG00000066129

DomainStartEndE-ValueType
KIND 37 217 4.66e-65 SMART
Blast:KIND 381 454 2e-10 BLAST
KIND 456 620 1.22e-50 SMART
low complexity region 658 670 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
low complexity region 792 801 N/A INTRINSIC
low complexity region 949 965 N/A INTRINSIC
coiled coil region 1121 1151 N/A INTRINSIC
Pfam:RasGEF_N 1242 1341 2.2e-17 PFAM
Pfam:RasGEF 1464 1672 3.8e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154782
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156941
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 92% (105/114)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a Ras guanine nucleotide exchange factor that appears to negatively regulate dendritic growth in the brain. Knockdown of this gene in senescent umbilical vein endothelial cells partially reversed the senescence, showing that this gene could potentially be targeted by anti-aging therapies. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg5 T G 17: 84,981,022 (GRCm39) Y107S possibly damaging Het
Abhd8 T C 8: 71,914,499 (GRCm39) E43G probably damaging Het
Ap1b1 T G 11: 4,990,360 (GRCm39) L872W probably damaging Het
Arid1b T A 17: 5,389,518 (GRCm39) M1688K probably damaging Het
Brca1 T C 11: 101,413,248 (GRCm39) probably benign Het
C4b C T 17: 34,952,675 (GRCm39) V1151I probably benign Het
Card6 T A 15: 5,128,113 (GRCm39) Q1094H unknown Het
Cd22 C A 7: 30,577,224 (GRCm39) V28F possibly damaging Het
Cdc42bpa A T 1: 179,859,125 (GRCm39) N109I probably damaging Het
Ces2b T C 8: 105,563,442 (GRCm39) Y390H probably damaging Het
Clca4a T C 3: 144,674,072 (GRCm39) Y221C probably damaging Het
Cntnap5a G T 1: 115,612,686 (GRCm39) probably benign Het
Cyp4a10 C A 4: 115,382,072 (GRCm39) H251Q probably damaging Het
Dcc A T 18: 71,517,297 (GRCm39) probably null Het
Dnaaf5 A G 5: 139,171,273 (GRCm39) K812E possibly damaging Het
Dnajc13 T C 9: 104,115,672 (GRCm39) T46A probably damaging Het
Duxf1 A G 10: 58,059,276 (GRCm39) C493R probably benign Het
Duxf1 C T 10: 58,060,704 (GRCm39) E17K possibly damaging Het
Duxf1 G A 10: 58,060,136 (GRCm39) probably benign Het
Duxf1 G C 10: 58,059,278 (GRCm39) P492R probably damaging Het
Duxf3 C A 10: 58,066,990 (GRCm39) C503F probably damaging Het
Duxf3 C A 10: 58,066,810 (GRCm39) R563M probably damaging Het
Duxf3 A C 10: 58,067,498 (GRCm39) S27A probably benign Het
Eps8l1 G A 7: 4,474,414 (GRCm39) S295N probably benign Het
Etfdh C T 3: 79,517,174 (GRCm39) S345N probably damaging Het
Fat3 A G 9: 15,903,414 (GRCm39) probably null Het
G530012D18Rik T G 1: 85,504,925 (GRCm39) probably benign Het
Gabra4 T C 5: 71,729,106 (GRCm39) N558S probably damaging Het
Gm10718 A T 9: 3,024,417 (GRCm39) T134S probably benign Het
Gm10722 T C 9: 3,001,350 (GRCm39) L142S probably benign Het
Gm10800 T C 2: 98,497,163 (GRCm39) R152G probably benign Het
Gm10800 C A 2: 98,497,250 (GRCm39) V123F probably benign Het
Gm10800 CAAGAAAACTGAAAATCA C 2: 98,497,361 (GRCm39) probably null Het
Gm10800 A C 2: 98,496,893 (GRCm39) F220C probably benign Het
Gm10801 A G 2: 98,492,648 (GRCm39) R23G probably benign Het
Gm11168 C T 9: 3,004,605 (GRCm39) P49S probably benign Het
Gm21663 C T 5: 26,143,767 (GRCm39) R185H probably benign Het
Gm21738 G A 14: 19,417,330 (GRCm38) S66L probably benign Het
Gpr107 T A 2: 31,057,083 (GRCm39) D58E probably benign Het
Gstm7 AAC A 3: 107,838,799 (GRCm39) probably null Het
Hc C T 2: 34,921,833 (GRCm39) probably benign Het
Hjurp A G 1: 88,194,283 (GRCm39) probably benign Het
Hjurp T C 1: 88,194,338 (GRCm39) E190G probably benign Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTG T 1: 88,194,000 (GRCm39) probably benign Het
Hjurp A C 1: 88,193,768 (GRCm39) V380G probably damaging Het
Hnrnpa2b1 A T 6: 51,441,089 (GRCm39) M327K probably benign Het
Hoxa13 G C 6: 52,260,648 (GRCm38) probably benign Het
Hoxa13 C G 6: 52,260,647 (GRCm38) probably benign Het
Ifi206 A G 1: 173,308,730 (GRCm39) V422A probably benign Het
Igf2bp3 A G 6: 49,094,317 (GRCm39) V151A probably damaging Het
Ivl TTGC T 3: 92,479,608 (GRCm39) probably benign Het
Lig1 GC G 7: 13,039,850 (GRCm39) probably null Het
Lrit1 A G 14: 36,783,998 (GRCm39) Y442C probably damaging Het
Map3k21 C A 8: 126,664,047 (GRCm39) P536H probably damaging Het
Marchf10 T A 11: 105,281,346 (GRCm39) Y313F probably benign Het
Mcm5 A G 8: 75,853,864 (GRCm39) H706R probably benign Het
Mlycd T G 8: 120,137,199 (GRCm39) I473S probably damaging Het
Muc4 T A 16: 32,755,684 (GRCm38) probably benign Het
Muc4 C A 16: 32,754,529 (GRCm38) H1468N probably benign Het
Muc4 C G 16: 32,755,676 (GRCm38) probably benign Het
Myo5c T C 9: 75,191,230 (GRCm39) V1088A probably benign Het
Nadk2 TG T 15: 9,100,232 (GRCm39) probably null Het
Ndufs1 A G 1: 63,198,907 (GRCm39) probably benign Het
Or4n4 A G 14: 50,518,784 (GRCm39) *309Q probably null Het
Pak2 A T 16: 31,841,930 (GRCm39) Y443N probably damaging Het
Pik3r6 T C 11: 68,417,931 (GRCm39) I73T probably damaging Het
Pla2g4c A G 7: 13,077,316 (GRCm39) E286G probably benign Het
Plekhn1 G A 4: 156,309,397 (GRCm39) R196* probably null Het
Pramel41 A C 5: 94,594,643 (GRCm39) K168Q probably benign Het
Prdm10 T A 9: 31,237,063 (GRCm39) D145E probably benign Het
Ptgis T C 2: 167,048,750 (GRCm39) Y422C probably damaging Het
Ralgapb A G 2: 158,272,342 (GRCm39) E132G probably benign Het
Rasgrf1 G A 9: 89,797,626 (GRCm39) R168H possibly damaging Het
Rbmyf1 T A Y: 2,787,132 (GRCm39) N228Y probably benign Het
Rpl5 T C 5: 108,055,049 (GRCm39) probably benign Het
Ryr2 T C 13: 11,722,682 (GRCm39) K2603E probably damaging Het
Sap130 T C 18: 31,800,064 (GRCm39) probably null Het
Scn5a C A 9: 119,315,324 (GRCm39) D1794Y probably damaging Het
Sec31a A T 5: 100,555,134 (GRCm39) S29T probably damaging Het
Selplg T G 5: 113,957,689 (GRCm39) K206Q probably benign Het
Sfmbt1 A T 14: 30,538,714 (GRCm39) probably null Het
Sirpb1a A T 3: 15,476,258 (GRCm39) F180I probably benign Het
Slc44a4 A G 17: 35,140,251 (GRCm39) I67V probably damaging Het
Sp110 T C 1: 85,513,975 (GRCm39) R261G probably benign Het
Sp110 C T 1: 85,513,971 (GRCm39) R262Q probably benign Het
Sp140 T A 1: 85,528,893 (GRCm39) Y5N probably benign Het
Sp140 A G 1: 85,570,942 (GRCm39) S461G probably benign Het
Sp140 G C 1: 85,538,603 (GRCm39) K113N probably benign Het
Sp140l1 G A 1: 85,077,341 (GRCm39) A75V probably benign Het
Sp140l2 A C 1: 85,223,395 (GRCm39) probably benign Het
Speer4a2 A T 5: 26,291,485 (GRCm39) F107Y probably benign Het
Speer4a2 C G 5: 26,294,093 (GRCm39) W28C probably damaging Het
Stab2 A T 10: 86,703,039 (GRCm39) S1848R possibly damaging Het
Stat6 T C 10: 127,494,099 (GRCm39) V642A possibly damaging Het
Tfam T C 10: 71,070,813 (GRCm39) K63R possibly damaging Het
Trim2 T C 3: 84,098,164 (GRCm39) N379S probably benign Het
Trp63 C T 16: 25,684,013 (GRCm39) T300I probably damaging Het
Tymp C A 15: 89,260,548 (GRCm39) W90L probably damaging Het
Ubr5 A G 15: 38,042,153 (GRCm39) S148P Het
Ugt1a10 TTCA T 1: 88,143,880 (GRCm39) probably benign Het
Usp47 T C 7: 111,703,548 (GRCm39) probably benign Het
Uvssa C T 5: 33,549,428 (GRCm39) A363V probably benign Het
Vldlr T A 19: 27,212,269 (GRCm39) D94E probably benign Het
Vmn1r3 C T 4: 3,184,691 (GRCm39) M205I probably damaging Het
Vmn1r3 C T 4: 3,184,774 (GRCm39) V178I probably benign Het
Vmn1r67 T A 7: 10,180,877 (GRCm39) M47K probably benign Het
Vmn1r87 A T 7: 12,866,112 (GRCm39) H58Q probably benign Het
Vmn1r89 A G 7: 12,953,515 (GRCm39) T84A probably benign Het
Vmn2r109 T C 17: 20,774,839 (GRCm39) probably null Het
Xirp2 T C 2: 67,349,706 (GRCm39) probably benign Het
Zbtb2 A G 10: 4,319,493 (GRCm39) S178P probably benign Het
Zfp534 C T 4: 147,760,031 (GRCm39) E213K probably benign Het
Zfp534 C A 4: 147,762,770 (GRCm39) D21Y probably benign Het
Zfp804b C T 5: 6,819,422 (GRCm39) V1214I probably damaging Het
Zfp82 G T 7: 29,756,701 (GRCm39) T63K probably damaging Het
Zfp986 C T 4: 145,625,513 (GRCm39) R58C probably benign Het
Zfp992 C T 4: 146,550,569 (GRCm39) P97S probably benign Het
Other mutations in Kndc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Kndc1 APN 7 139,481,904 (GRCm39) splice site probably benign
IGL01061:Kndc1 APN 7 139,502,610 (GRCm39) missense probably benign 0.00
IGL01099:Kndc1 APN 7 139,500,700 (GRCm39) missense probably damaging 1.00
IGL01522:Kndc1 APN 7 139,493,888 (GRCm39) splice site probably benign
IGL01767:Kndc1 APN 7 139,509,959 (GRCm39) missense probably damaging 1.00
IGL01884:Kndc1 APN 7 139,494,110 (GRCm39) missense probably damaging 1.00
IGL01932:Kndc1 APN 7 139,503,705 (GRCm39) missense probably damaging 0.98
IGL02133:Kndc1 APN 7 139,500,683 (GRCm39) missense probably benign 0.19
IGL02411:Kndc1 APN 7 139,501,829 (GRCm39) critical splice donor site probably null
IGL02472:Kndc1 APN 7 139,490,817 (GRCm39) missense probably benign 0.01
IGL02537:Kndc1 APN 7 139,490,326 (GRCm39) missense probably benign 0.01
IGL02708:Kndc1 APN 7 139,481,097 (GRCm39) missense probably damaging 1.00
IGL03115:Kndc1 APN 7 139,501,425 (GRCm39) missense probably benign 0.28
IGL03160:Kndc1 APN 7 139,500,605 (GRCm39) nonsense probably null
IGL03138:Kndc1 UTSW 7 139,519,791 (GRCm39) missense possibly damaging 0.89
PIT4696001:Kndc1 UTSW 7 139,512,830 (GRCm39) missense probably damaging 1.00
R0349:Kndc1 UTSW 7 139,490,220 (GRCm39) missense probably benign 0.00
R0384:Kndc1 UTSW 7 139,490,515 (GRCm39) missense possibly damaging 0.85
R0415:Kndc1 UTSW 7 139,510,037 (GRCm39) missense probably damaging 1.00
R0421:Kndc1 UTSW 7 139,488,912 (GRCm39) missense probably damaging 1.00
R0487:Kndc1 UTSW 7 139,493,939 (GRCm39) missense probably null 0.19
R0530:Kndc1 UTSW 7 139,481,153 (GRCm39) missense probably damaging 1.00
R0905:Kndc1 UTSW 7 139,503,651 (GRCm39) missense possibly damaging 0.94
R1434:Kndc1 UTSW 7 139,502,600 (GRCm39) missense probably damaging 1.00
R1608:Kndc1 UTSW 7 139,507,321 (GRCm39) missense possibly damaging 0.80
R1644:Kndc1 UTSW 7 139,510,669 (GRCm39) missense probably damaging 1.00
R1835:Kndc1 UTSW 7 139,507,624 (GRCm39) missense probably damaging 0.99
R2012:Kndc1 UTSW 7 139,501,196 (GRCm39) missense possibly damaging 0.90
R2102:Kndc1 UTSW 7 139,510,674 (GRCm39) missense probably benign 0.02
R2103:Kndc1 UTSW 7 139,501,150 (GRCm39) missense probably benign 0.01
R2128:Kndc1 UTSW 7 139,510,025 (GRCm39) missense probably damaging 1.00
R2516:Kndc1 UTSW 7 139,501,738 (GRCm39) missense probably damaging 1.00
R3030:Kndc1 UTSW 7 139,481,123 (GRCm39) missense probably damaging 1.00
R3617:Kndc1 UTSW 7 139,481,976 (GRCm39) splice site probably benign
R3747:Kndc1 UTSW 7 139,507,817 (GRCm39) critical splice donor site probably null
R3848:Kndc1 UTSW 7 139,488,893 (GRCm39) missense probably damaging 1.00
R4028:Kndc1 UTSW 7 139,509,941 (GRCm39) missense probably damaging 0.98
R4043:Kndc1 UTSW 7 139,504,044 (GRCm39) missense probably benign 0.06
R4044:Kndc1 UTSW 7 139,504,044 (GRCm39) missense probably benign 0.06
R4095:Kndc1 UTSW 7 139,516,938 (GRCm39) missense possibly damaging 0.49
R4289:Kndc1 UTSW 7 139,490,798 (GRCm39) missense probably benign 0.01
R4478:Kndc1 UTSW 7 139,500,600 (GRCm39) missense probably damaging 1.00
R4514:Kndc1 UTSW 7 139,490,202 (GRCm39) missense probably benign 0.00
R4540:Kndc1 UTSW 7 139,501,343 (GRCm39) nonsense probably null
R4584:Kndc1 UTSW 7 139,481,159 (GRCm39) missense probably damaging 1.00
R4693:Kndc1 UTSW 7 139,501,695 (GRCm39) missense probably benign 0.02
R4705:Kndc1 UTSW 7 139,510,036 (GRCm39) missense possibly damaging 0.81
R4773:Kndc1 UTSW 7 139,503,946 (GRCm39) nonsense probably null
R4859:Kndc1 UTSW 7 139,501,821 (GRCm39) missense probably benign 0.03
R5004:Kndc1 UTSW 7 139,512,792 (GRCm39) nonsense probably null
R5037:Kndc1 UTSW 7 139,490,371 (GRCm39) missense possibly damaging 0.52
R5322:Kndc1 UTSW 7 139,516,722 (GRCm39) missense probably damaging 1.00
R5428:Kndc1 UTSW 7 139,488,878 (GRCm39) missense probably damaging 0.99
R5503:Kndc1 UTSW 7 139,511,802 (GRCm39) missense probably damaging 1.00
R5506:Kndc1 UTSW 7 139,507,804 (GRCm39) missense probably damaging 1.00
R5525:Kndc1 UTSW 7 139,504,026 (GRCm39) missense probably benign 0.00
R5888:Kndc1 UTSW 7 139,475,133 (GRCm39) missense probably benign 0.00
R5942:Kndc1 UTSW 7 139,516,792 (GRCm39) missense probably damaging 1.00
R5979:Kndc1 UTSW 7 139,519,740 (GRCm39) missense probably benign 0.05
R5990:Kndc1 UTSW 7 139,507,333 (GRCm39) missense probably damaging 0.99
R6038:Kndc1 UTSW 7 139,503,691 (GRCm39) frame shift probably null
R6076:Kndc1 UTSW 7 139,481,954 (GRCm39) missense probably damaging 1.00
R6118:Kndc1 UTSW 7 139,503,717 (GRCm39) missense probably damaging 1.00
R6151:Kndc1 UTSW 7 139,501,129 (GRCm39) missense probably benign 0.04
R6276:Kndc1 UTSW 7 139,500,979 (GRCm39) missense probably benign
R6367:Kndc1 UTSW 7 139,493,422 (GRCm39) missense probably damaging 1.00
R6726:Kndc1 UTSW 7 139,502,667 (GRCm39) critical splice donor site probably null
R6745:Kndc1 UTSW 7 139,500,892 (GRCm39) missense probably benign 0.02
R6886:Kndc1 UTSW 7 139,493,485 (GRCm39) missense probably benign 0.01
R6912:Kndc1 UTSW 7 139,490,194 (GRCm39) missense probably damaging 0.99
R7070:Kndc1 UTSW 7 139,501,744 (GRCm39) missense probably damaging 1.00
R7123:Kndc1 UTSW 7 139,516,749 (GRCm39) missense probably damaging 0.99
R7158:Kndc1 UTSW 7 139,511,773 (GRCm39) missense possibly damaging 0.48
R7248:Kndc1 UTSW 7 139,500,699 (GRCm39) missense probably damaging 1.00
R7437:Kndc1 UTSW 7 139,488,959 (GRCm39) missense probably damaging 1.00
R7564:Kndc1 UTSW 7 139,500,612 (GRCm39) missense probably benign 0.01
R7570:Kndc1 UTSW 7 139,503,691 (GRCm39) frame shift probably null
R7625:Kndc1 UTSW 7 139,517,930 (GRCm39) missense possibly damaging 0.90
R7629:Kndc1 UTSW 7 139,475,176 (GRCm39) missense probably damaging 1.00
R7726:Kndc1 UTSW 7 139,519,751 (GRCm39) missense possibly damaging 0.67
R7840:Kndc1 UTSW 7 139,503,731 (GRCm39) missense probably damaging 1.00
R7859:Kndc1 UTSW 7 139,500,880 (GRCm39) missense possibly damaging 0.57
R7934:Kndc1 UTSW 7 139,501,402 (GRCm39) missense probably benign 0.02
R8011:Kndc1 UTSW 7 139,490,536 (GRCm39) missense possibly damaging 0.90
R8062:Kndc1 UTSW 7 139,498,760 (GRCm39) missense probably benign 0.01
R8134:Kndc1 UTSW 7 139,481,285 (GRCm39) splice site probably null
R8197:Kndc1 UTSW 7 139,493,447 (GRCm39) missense probably damaging 1.00
R8350:Kndc1 UTSW 7 139,503,960 (GRCm39) missense probably damaging 1.00
R8399:Kndc1 UTSW 7 139,493,434 (GRCm39) missense probably damaging 1.00
R8400:Kndc1 UTSW 7 139,493,434 (GRCm39) missense probably damaging 1.00
R8447:Kndc1 UTSW 7 139,481,121 (GRCm39) missense probably damaging 1.00
R8534:Kndc1 UTSW 7 139,503,669 (GRCm39) missense probably benign 0.27
R8735:Kndc1 UTSW 7 139,490,130 (GRCm39) missense probably benign 0.00
R8816:Kndc1 UTSW 7 139,517,909 (GRCm39) missense probably damaging 1.00
R8883:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R8899:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R8961:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R8961:Kndc1 UTSW 7 139,503,976 (GRCm39) missense possibly damaging 0.95
R9002:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9010:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9065:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9066:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9223:Kndc1 UTSW 7 139,501,357 (GRCm39) missense possibly damaging 0.89
R9230:Kndc1 UTSW 7 139,500,600 (GRCm39) missense probably damaging 1.00
R9291:Kndc1 UTSW 7 139,475,140 (GRCm39) missense possibly damaging 0.55
R9441:Kndc1 UTSW 7 139,501,392 (GRCm39) missense probably damaging 0.99
R9476:Kndc1 UTSW 7 139,510,031 (GRCm39) missense probably benign 0.00
R9510:Kndc1 UTSW 7 139,510,031 (GRCm39) missense probably benign 0.00
R9518:Kndc1 UTSW 7 139,519,827 (GRCm39) missense probably damaging 1.00
R9758:Kndc1 UTSW 7 139,500,620 (GRCm39) missense possibly damaging 0.71
Z1177:Kndc1 UTSW 7 139,501,828 (GRCm39) missense possibly damaging 0.63
Z1186:Kndc1 UTSW 7 139,490,729 (GRCm39) missense probably damaging 0.98
Predicted Primers
Posted On 2017-09-21