Incidental Mutation 'PIT4142001:Ces2b'
ID 486935
Institutional Source Beutler Lab
Gene Symbol Ces2b
Ensembl Gene ENSMUSG00000050097
Gene Name carboxyesterase 2B
Synonyms
Accession Numbers
Essential gene? Probably non essential (E-score: 0.050) question?
Stock # PIT4142001 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 105558204-105566725 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 105563442 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 390 (Y390H)
Ref Sequence ENSEMBL: ENSMUSP00000063005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059449] [ENSMUST00000163042]
AlphaFold Q6PDB7
Predicted Effect probably damaging
Transcript: ENSMUST00000059449
AA Change: Y390H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063005
Gene: ENSMUSG00000050097
AA Change: Y390H

DomainStartEndE-ValueType
Pfam:COesterase 10 535 8.5e-175 PFAM
Pfam:Abhydrolase_3 140 305 1.8e-11 PFAM
Pfam:Peptidase_S9 161 296 9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163042
SMART Domains Protein: ENSMUSP00000124796
Gene: ENSMUSG00000050097

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Meta Mutation Damage Score 0.3523 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 92% (105/114)
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg5 T G 17: 84,981,022 (GRCm39) Y107S possibly damaging Het
Abhd8 T C 8: 71,914,499 (GRCm39) E43G probably damaging Het
Ap1b1 T G 11: 4,990,360 (GRCm39) L872W probably damaging Het
Arid1b T A 17: 5,389,518 (GRCm39) M1688K probably damaging Het
Brca1 T C 11: 101,413,248 (GRCm39) probably benign Het
C4b C T 17: 34,952,675 (GRCm39) V1151I probably benign Het
Card6 T A 15: 5,128,113 (GRCm39) Q1094H unknown Het
Cd22 C A 7: 30,577,224 (GRCm39) V28F possibly damaging Het
Cdc42bpa A T 1: 179,859,125 (GRCm39) N109I probably damaging Het
Clca4a T C 3: 144,674,072 (GRCm39) Y221C probably damaging Het
Cntnap5a G T 1: 115,612,686 (GRCm39) probably benign Het
Cyp4a10 C A 4: 115,382,072 (GRCm39) H251Q probably damaging Het
Dcc A T 18: 71,517,297 (GRCm39) probably null Het
Dnaaf5 A G 5: 139,171,273 (GRCm39) K812E possibly damaging Het
Dnajc13 T C 9: 104,115,672 (GRCm39) T46A probably damaging Het
Duxf1 A G 10: 58,059,276 (GRCm39) C493R probably benign Het
Duxf1 C T 10: 58,060,704 (GRCm39) E17K possibly damaging Het
Duxf1 G A 10: 58,060,136 (GRCm39) probably benign Het
Duxf1 G C 10: 58,059,278 (GRCm39) P492R probably damaging Het
Duxf3 C A 10: 58,066,990 (GRCm39) C503F probably damaging Het
Duxf3 C A 10: 58,066,810 (GRCm39) R563M probably damaging Het
Duxf3 A C 10: 58,067,498 (GRCm39) S27A probably benign Het
Eps8l1 G A 7: 4,474,414 (GRCm39) S295N probably benign Het
Etfdh C T 3: 79,517,174 (GRCm39) S345N probably damaging Het
Fat3 A G 9: 15,903,414 (GRCm39) probably null Het
G530012D18Rik T G 1: 85,504,925 (GRCm39) probably benign Het
Gabra4 T C 5: 71,729,106 (GRCm39) N558S probably damaging Het
Gm10718 A T 9: 3,024,417 (GRCm39) T134S probably benign Het
Gm10722 T C 9: 3,001,350 (GRCm39) L142S probably benign Het
Gm10800 A C 2: 98,496,893 (GRCm39) F220C probably benign Het
Gm10800 T C 2: 98,497,163 (GRCm39) R152G probably benign Het
Gm10800 C A 2: 98,497,250 (GRCm39) V123F probably benign Het
Gm10800 CAAGAAAACTGAAAATCA C 2: 98,497,361 (GRCm39) probably null Het
Gm10801 A G 2: 98,492,648 (GRCm39) R23G probably benign Het
Gm11168 C T 9: 3,004,605 (GRCm39) P49S probably benign Het
Gm21663 C T 5: 26,143,767 (GRCm39) R185H probably benign Het
Gm21738 G A 14: 19,417,330 (GRCm38) S66L probably benign Het
Gpr107 T A 2: 31,057,083 (GRCm39) D58E probably benign Het
Gstm7 AAC A 3: 107,838,799 (GRCm39) probably null Het
Hc C T 2: 34,921,833 (GRCm39) probably benign Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTG T 1: 88,194,000 (GRCm39) probably benign Het
Hjurp A G 1: 88,194,283 (GRCm39) probably benign Het
Hjurp T C 1: 88,194,338 (GRCm39) E190G probably benign Het
Hjurp A C 1: 88,193,768 (GRCm39) V380G probably damaging Het
Hnrnpa2b1 A T 6: 51,441,089 (GRCm39) M327K probably benign Het
Hoxa13 G C 6: 52,260,648 (GRCm38) probably benign Het
Hoxa13 C G 6: 52,260,647 (GRCm38) probably benign Het
Ifi206 A G 1: 173,308,730 (GRCm39) V422A probably benign Het
Igf2bp3 A G 6: 49,094,317 (GRCm39) V151A probably damaging Het
Ivl TTGC T 3: 92,479,608 (GRCm39) probably benign Het
Kndc1 TC T 7: 139,503,692 (GRCm39) probably null Het
Lig1 GC G 7: 13,039,850 (GRCm39) probably null Het
Lrit1 A G 14: 36,783,998 (GRCm39) Y442C probably damaging Het
Map3k21 C A 8: 126,664,047 (GRCm39) P536H probably damaging Het
Marchf10 T A 11: 105,281,346 (GRCm39) Y313F probably benign Het
Mcm5 A G 8: 75,853,864 (GRCm39) H706R probably benign Het
Mlycd T G 8: 120,137,199 (GRCm39) I473S probably damaging Het
Muc4 T A 16: 32,755,684 (GRCm38) probably benign Het
Muc4 C A 16: 32,754,529 (GRCm38) H1468N probably benign Het
Muc4 C G 16: 32,755,676 (GRCm38) probably benign Het
Myo5c T C 9: 75,191,230 (GRCm39) V1088A probably benign Het
Nadk2 TG T 15: 9,100,232 (GRCm39) probably null Het
Ndufs1 A G 1: 63,198,907 (GRCm39) probably benign Het
Or4n4 A G 14: 50,518,784 (GRCm39) *309Q probably null Het
Pak2 A T 16: 31,841,930 (GRCm39) Y443N probably damaging Het
Pik3r6 T C 11: 68,417,931 (GRCm39) I73T probably damaging Het
Pla2g4c A G 7: 13,077,316 (GRCm39) E286G probably benign Het
Plekhn1 G A 4: 156,309,397 (GRCm39) R196* probably null Het
Pramel41 A C 5: 94,594,643 (GRCm39) K168Q probably benign Het
Prdm10 T A 9: 31,237,063 (GRCm39) D145E probably benign Het
Ptgis T C 2: 167,048,750 (GRCm39) Y422C probably damaging Het
Ralgapb A G 2: 158,272,342 (GRCm39) E132G probably benign Het
Rasgrf1 G A 9: 89,797,626 (GRCm39) R168H possibly damaging Het
Rbmyf1 T A Y: 2,787,132 (GRCm39) N228Y probably benign Het
Rpl5 T C 5: 108,055,049 (GRCm39) probably benign Het
Ryr2 T C 13: 11,722,682 (GRCm39) K2603E probably damaging Het
Sap130 T C 18: 31,800,064 (GRCm39) probably null Het
Scn5a C A 9: 119,315,324 (GRCm39) D1794Y probably damaging Het
Sec31a A T 5: 100,555,134 (GRCm39) S29T probably damaging Het
Selplg T G 5: 113,957,689 (GRCm39) K206Q probably benign Het
Sfmbt1 A T 14: 30,538,714 (GRCm39) probably null Het
Sirpb1a A T 3: 15,476,258 (GRCm39) F180I probably benign Het
Slc44a4 A G 17: 35,140,251 (GRCm39) I67V probably damaging Het
Sp110 T C 1: 85,513,975 (GRCm39) R261G probably benign Het
Sp110 C T 1: 85,513,971 (GRCm39) R262Q probably benign Het
Sp140 T A 1: 85,528,893 (GRCm39) Y5N probably benign Het
Sp140 A G 1: 85,570,942 (GRCm39) S461G probably benign Het
Sp140 G C 1: 85,538,603 (GRCm39) K113N probably benign Het
Sp140l1 G A 1: 85,077,341 (GRCm39) A75V probably benign Het
Sp140l2 A C 1: 85,223,395 (GRCm39) probably benign Het
Speer4a2 A T 5: 26,291,485 (GRCm39) F107Y probably benign Het
Speer4a2 C G 5: 26,294,093 (GRCm39) W28C probably damaging Het
Stab2 A T 10: 86,703,039 (GRCm39) S1848R possibly damaging Het
Stat6 T C 10: 127,494,099 (GRCm39) V642A possibly damaging Het
Tfam T C 10: 71,070,813 (GRCm39) K63R possibly damaging Het
Trim2 T C 3: 84,098,164 (GRCm39) N379S probably benign Het
Trp63 C T 16: 25,684,013 (GRCm39) T300I probably damaging Het
Tymp C A 15: 89,260,548 (GRCm39) W90L probably damaging Het
Ubr5 A G 15: 38,042,153 (GRCm39) S148P Het
Ugt1a10 TTCA T 1: 88,143,880 (GRCm39) probably benign Het
Usp47 T C 7: 111,703,548 (GRCm39) probably benign Het
Uvssa C T 5: 33,549,428 (GRCm39) A363V probably benign Het
Vldlr T A 19: 27,212,269 (GRCm39) D94E probably benign Het
Vmn1r3 C T 4: 3,184,691 (GRCm39) M205I probably damaging Het
Vmn1r3 C T 4: 3,184,774 (GRCm39) V178I probably benign Het
Vmn1r67 T A 7: 10,180,877 (GRCm39) M47K probably benign Het
Vmn1r87 A T 7: 12,866,112 (GRCm39) H58Q probably benign Het
Vmn1r89 A G 7: 12,953,515 (GRCm39) T84A probably benign Het
Vmn2r109 T C 17: 20,774,839 (GRCm39) probably null Het
Xirp2 T C 2: 67,349,706 (GRCm39) probably benign Het
Zbtb2 A G 10: 4,319,493 (GRCm39) S178P probably benign Het
Zfp534 C A 4: 147,762,770 (GRCm39) D21Y probably benign Het
Zfp534 C T 4: 147,760,031 (GRCm39) E213K probably benign Het
Zfp804b C T 5: 6,819,422 (GRCm39) V1214I probably damaging Het
Zfp82 G T 7: 29,756,701 (GRCm39) T63K probably damaging Het
Zfp986 C T 4: 145,625,513 (GRCm39) R58C probably benign Het
Zfp992 C T 4: 146,550,569 (GRCm39) P97S probably benign Het
Other mutations in Ces2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01388:Ces2b APN 8 105,561,236 (GRCm39) splice site probably benign
IGL01905:Ces2b APN 8 105,560,594 (GRCm39) missense probably damaging 1.00
IGL02528:Ces2b APN 8 105,561,601 (GRCm39) missense probably damaging 1.00
IGL02659:Ces2b APN 8 105,559,202 (GRCm39) splice site probably benign
IGL02885:Ces2b APN 8 105,561,563 (GRCm39) missense probably damaging 1.00
R0092:Ces2b UTSW 8 105,563,144 (GRCm39) missense possibly damaging 0.48
R0403:Ces2b UTSW 8 105,560,577 (GRCm39) missense probably damaging 0.98
R0600:Ces2b UTSW 8 105,562,542 (GRCm39) missense probably benign 0.06
R0637:Ces2b UTSW 8 105,561,237 (GRCm39) splice site probably benign
R1574:Ces2b UTSW 8 105,562,521 (GRCm39) missense probably benign 0.16
R1574:Ces2b UTSW 8 105,562,521 (GRCm39) missense probably benign 0.16
R3036:Ces2b UTSW 8 105,561,258 (GRCm39) missense possibly damaging 0.87
R3086:Ces2b UTSW 8 105,559,401 (GRCm39) missense possibly damaging 0.92
R4761:Ces2b UTSW 8 105,563,193 (GRCm39) critical splice donor site probably null
R4920:Ces2b UTSW 8 105,563,538 (GRCm39) missense probably benign
R4937:Ces2b UTSW 8 105,559,413 (GRCm39) missense probably benign 0.29
R5211:Ces2b UTSW 8 105,561,695 (GRCm39) missense possibly damaging 0.89
R5550:Ces2b UTSW 8 105,565,069 (GRCm39) missense probably benign 0.00
R5790:Ces2b UTSW 8 105,560,568 (GRCm39) missense probably damaging 1.00
R6403:Ces2b UTSW 8 105,562,901 (GRCm39) nonsense probably null
R6692:Ces2b UTSW 8 105,563,919 (GRCm39) missense probably damaging 1.00
R6720:Ces2b UTSW 8 105,563,501 (GRCm39) missense probably benign 0.32
R6899:Ces2b UTSW 8 105,563,398 (GRCm39) splice site probably null
R7148:Ces2b UTSW 8 105,564,928 (GRCm39) missense probably damaging 1.00
R7270:Ces2b UTSW 8 105,564,472 (GRCm39) missense possibly damaging 0.50
R7571:Ces2b UTSW 8 105,561,641 (GRCm39) missense probably damaging 1.00
R7626:Ces2b UTSW 8 105,564,017 (GRCm39) missense possibly damaging 0.82
R7841:Ces2b UTSW 8 105,561,692 (GRCm39) missense probably benign 0.19
R7892:Ces2b UTSW 8 105,559,385 (GRCm39) missense probably damaging 1.00
R8029:Ces2b UTSW 8 105,561,482 (GRCm39) missense probably damaging 1.00
R8293:Ces2b UTSW 8 105,559,258 (GRCm39) missense unknown
R8296:Ces2b UTSW 8 105,563,112 (GRCm39) missense possibly damaging 0.77
R8721:Ces2b UTSW 8 105,560,527 (GRCm39) missense possibly damaging 0.88
R9100:Ces2b UTSW 8 105,558,221 (GRCm39) unclassified probably benign
R9361:Ces2b UTSW 8 105,564,039 (GRCm39) critical splice donor site probably null
R9461:Ces2b UTSW 8 105,564,011 (GRCm39) missense probably benign 0.39
R9477:Ces2b UTSW 8 105,560,556 (GRCm39) missense probably damaging 1.00
X0027:Ces2b UTSW 8 105,560,560 (GRCm39) missense probably damaging 1.00
Z1177:Ces2b UTSW 8 105,559,227 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGCTGTTTTGAAGAATACAACAGC -3'
(R):5'- AATCTGGACATGAGGAGGCC -3'

Sequencing Primer
(F):5'- GGTAAAATAGCTCTCATTCTGTCC -3'
(R):5'- CATGAGGAGGCCTGGACAC -3'
Posted On 2017-09-21