Incidental Mutation 'PIT4142001:C4b'
ID 486967
Institutional Source Beutler Lab
Gene Symbol C4b
Ensembl Gene ENSMUSG00000073418
Gene Name complement C4B (Chido blood group)
Synonyms Ss, C4
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # PIT4142001 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 34947354-34962856 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 34952675 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 1151 (V1151I)
Ref Sequence ENSEMBL: ENSMUSP00000069418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069507]
AlphaFold P01029
Predicted Effect probably benign
Transcript: ENSMUST00000069507
AA Change: V1151I

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418
AA Change: V1151I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:A2M_N 138 231 2e-19 PFAM
A2M_N_2 470 609 2.87e-26 SMART
ANATO 700 734 3.58e-12 SMART
low complexity region 761 771 N/A INTRINSIC
A2M 779 867 1.46e-27 SMART
Pfam:Thiol-ester_cl 995 1024 7.7e-13 PFAM
Pfam:A2M_comp 1047 1313 1.3e-82 PFAM
low complexity region 1441 1447 N/A INTRINSIC
A2M_recep 1475 1564 1.03e-36 SMART
C345C 1608 1720 5.69e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173057
SMART Domains Protein: ENSMUSP00000134611
Gene: ENSMUSG00000073418

DomainStartEndE-ValueType
Pfam:A2M 1 62 6.5e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173669
Meta Mutation Damage Score 0.1012 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 92% (105/114)
MGI Phenotype PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg5 T G 17: 84,981,022 (GRCm39) Y107S possibly damaging Het
Abhd8 T C 8: 71,914,499 (GRCm39) E43G probably damaging Het
Ap1b1 T G 11: 4,990,360 (GRCm39) L872W probably damaging Het
Arid1b T A 17: 5,389,518 (GRCm39) M1688K probably damaging Het
Brca1 T C 11: 101,413,248 (GRCm39) probably benign Het
Card6 T A 15: 5,128,113 (GRCm39) Q1094H unknown Het
Cd22 C A 7: 30,577,224 (GRCm39) V28F possibly damaging Het
Cdc42bpa A T 1: 179,859,125 (GRCm39) N109I probably damaging Het
Ces2b T C 8: 105,563,442 (GRCm39) Y390H probably damaging Het
Clca4a T C 3: 144,674,072 (GRCm39) Y221C probably damaging Het
Cntnap5a G T 1: 115,612,686 (GRCm39) probably benign Het
Cyp4a10 C A 4: 115,382,072 (GRCm39) H251Q probably damaging Het
Dcc A T 18: 71,517,297 (GRCm39) probably null Het
Dnaaf5 A G 5: 139,171,273 (GRCm39) K812E possibly damaging Het
Dnajc13 T C 9: 104,115,672 (GRCm39) T46A probably damaging Het
Duxf1 A G 10: 58,059,276 (GRCm39) C493R probably benign Het
Duxf1 C T 10: 58,060,704 (GRCm39) E17K possibly damaging Het
Duxf1 G A 10: 58,060,136 (GRCm39) probably benign Het
Duxf1 G C 10: 58,059,278 (GRCm39) P492R probably damaging Het
Duxf3 C A 10: 58,066,990 (GRCm39) C503F probably damaging Het
Duxf3 C A 10: 58,066,810 (GRCm39) R563M probably damaging Het
Duxf3 A C 10: 58,067,498 (GRCm39) S27A probably benign Het
Eps8l1 G A 7: 4,474,414 (GRCm39) S295N probably benign Het
Etfdh C T 3: 79,517,174 (GRCm39) S345N probably damaging Het
Fat3 A G 9: 15,903,414 (GRCm39) probably null Het
G530012D18Rik T G 1: 85,504,925 (GRCm39) probably benign Het
Gabra4 T C 5: 71,729,106 (GRCm39) N558S probably damaging Het
Gm10718 A T 9: 3,024,417 (GRCm39) T134S probably benign Het
Gm10722 T C 9: 3,001,350 (GRCm39) L142S probably benign Het
Gm10800 A C 2: 98,496,893 (GRCm39) F220C probably benign Het
Gm10800 T C 2: 98,497,163 (GRCm39) R152G probably benign Het
Gm10800 C A 2: 98,497,250 (GRCm39) V123F probably benign Het
Gm10800 CAAGAAAACTGAAAATCA C 2: 98,497,361 (GRCm39) probably null Het
Gm10801 A G 2: 98,492,648 (GRCm39) R23G probably benign Het
Gm11168 C T 9: 3,004,605 (GRCm39) P49S probably benign Het
Gm21663 C T 5: 26,143,767 (GRCm39) R185H probably benign Het
Gm21738 G A 14: 19,417,330 (GRCm38) S66L probably benign Het
Gpr107 T A 2: 31,057,083 (GRCm39) D58E probably benign Het
Gstm7 AAC A 3: 107,838,799 (GRCm39) probably null Het
Hc C T 2: 34,921,833 (GRCm39) probably benign Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTG T 1: 88,194,000 (GRCm39) probably benign Het
Hjurp A G 1: 88,194,283 (GRCm39) probably benign Het
Hjurp T C 1: 88,194,338 (GRCm39) E190G probably benign Het
Hjurp A C 1: 88,193,768 (GRCm39) V380G probably damaging Het
Hnrnpa2b1 A T 6: 51,441,089 (GRCm39) M327K probably benign Het
Hoxa13 G C 6: 52,260,648 (GRCm38) probably benign Het
Hoxa13 C G 6: 52,260,647 (GRCm38) probably benign Het
Ifi206 A G 1: 173,308,730 (GRCm39) V422A probably benign Het
Igf2bp3 A G 6: 49,094,317 (GRCm39) V151A probably damaging Het
Ivl TTGC T 3: 92,479,608 (GRCm39) probably benign Het
Kndc1 TC T 7: 139,503,692 (GRCm39) probably null Het
Lig1 GC G 7: 13,039,850 (GRCm39) probably null Het
Lrit1 A G 14: 36,783,998 (GRCm39) Y442C probably damaging Het
Map3k21 C A 8: 126,664,047 (GRCm39) P536H probably damaging Het
Marchf10 T A 11: 105,281,346 (GRCm39) Y313F probably benign Het
Mcm5 A G 8: 75,853,864 (GRCm39) H706R probably benign Het
Mlycd T G 8: 120,137,199 (GRCm39) I473S probably damaging Het
Muc4 T A 16: 32,755,684 (GRCm38) probably benign Het
Muc4 C A 16: 32,754,529 (GRCm38) H1468N probably benign Het
Muc4 C G 16: 32,755,676 (GRCm38) probably benign Het
Myo5c T C 9: 75,191,230 (GRCm39) V1088A probably benign Het
Nadk2 TG T 15: 9,100,232 (GRCm39) probably null Het
Ndufs1 A G 1: 63,198,907 (GRCm39) probably benign Het
Or4n4 A G 14: 50,518,784 (GRCm39) *309Q probably null Het
Pak2 A T 16: 31,841,930 (GRCm39) Y443N probably damaging Het
Pik3r6 T C 11: 68,417,931 (GRCm39) I73T probably damaging Het
Pla2g4c A G 7: 13,077,316 (GRCm39) E286G probably benign Het
Plekhn1 G A 4: 156,309,397 (GRCm39) R196* probably null Het
Pramel41 A C 5: 94,594,643 (GRCm39) K168Q probably benign Het
Prdm10 T A 9: 31,237,063 (GRCm39) D145E probably benign Het
Ptgis T C 2: 167,048,750 (GRCm39) Y422C probably damaging Het
Ralgapb A G 2: 158,272,342 (GRCm39) E132G probably benign Het
Rasgrf1 G A 9: 89,797,626 (GRCm39) R168H possibly damaging Het
Rbmyf1 T A Y: 2,787,132 (GRCm39) N228Y probably benign Het
Rpl5 T C 5: 108,055,049 (GRCm39) probably benign Het
Ryr2 T C 13: 11,722,682 (GRCm39) K2603E probably damaging Het
Sap130 T C 18: 31,800,064 (GRCm39) probably null Het
Scn5a C A 9: 119,315,324 (GRCm39) D1794Y probably damaging Het
Sec31a A T 5: 100,555,134 (GRCm39) S29T probably damaging Het
Selplg T G 5: 113,957,689 (GRCm39) K206Q probably benign Het
Sfmbt1 A T 14: 30,538,714 (GRCm39) probably null Het
Sirpb1a A T 3: 15,476,258 (GRCm39) F180I probably benign Het
Slc44a4 A G 17: 35,140,251 (GRCm39) I67V probably damaging Het
Sp110 T C 1: 85,513,975 (GRCm39) R261G probably benign Het
Sp110 C T 1: 85,513,971 (GRCm39) R262Q probably benign Het
Sp140 T A 1: 85,528,893 (GRCm39) Y5N probably benign Het
Sp140 A G 1: 85,570,942 (GRCm39) S461G probably benign Het
Sp140 G C 1: 85,538,603 (GRCm39) K113N probably benign Het
Sp140l1 G A 1: 85,077,341 (GRCm39) A75V probably benign Het
Sp140l2 A C 1: 85,223,395 (GRCm39) probably benign Het
Speer4a2 A T 5: 26,291,485 (GRCm39) F107Y probably benign Het
Speer4a2 C G 5: 26,294,093 (GRCm39) W28C probably damaging Het
Stab2 A T 10: 86,703,039 (GRCm39) S1848R possibly damaging Het
Stat6 T C 10: 127,494,099 (GRCm39) V642A possibly damaging Het
Tfam T C 10: 71,070,813 (GRCm39) K63R possibly damaging Het
Trim2 T C 3: 84,098,164 (GRCm39) N379S probably benign Het
Trp63 C T 16: 25,684,013 (GRCm39) T300I probably damaging Het
Tymp C A 15: 89,260,548 (GRCm39) W90L probably damaging Het
Ubr5 A G 15: 38,042,153 (GRCm39) S148P Het
Ugt1a10 TTCA T 1: 88,143,880 (GRCm39) probably benign Het
Usp47 T C 7: 111,703,548 (GRCm39) probably benign Het
Uvssa C T 5: 33,549,428 (GRCm39) A363V probably benign Het
Vldlr T A 19: 27,212,269 (GRCm39) D94E probably benign Het
Vmn1r3 C T 4: 3,184,691 (GRCm39) M205I probably damaging Het
Vmn1r3 C T 4: 3,184,774 (GRCm39) V178I probably benign Het
Vmn1r67 T A 7: 10,180,877 (GRCm39) M47K probably benign Het
Vmn1r87 A T 7: 12,866,112 (GRCm39) H58Q probably benign Het
Vmn1r89 A G 7: 12,953,515 (GRCm39) T84A probably benign Het
Vmn2r109 T C 17: 20,774,839 (GRCm39) probably null Het
Xirp2 T C 2: 67,349,706 (GRCm39) probably benign Het
Zbtb2 A G 10: 4,319,493 (GRCm39) S178P probably benign Het
Zfp534 C A 4: 147,762,770 (GRCm39) D21Y probably benign Het
Zfp534 C T 4: 147,760,031 (GRCm39) E213K probably benign Het
Zfp804b C T 5: 6,819,422 (GRCm39) V1214I probably damaging Het
Zfp82 G T 7: 29,756,701 (GRCm39) T63K probably damaging Het
Zfp986 C T 4: 145,625,513 (GRCm39) R58C probably benign Het
Zfp992 C T 4: 146,550,569 (GRCm39) P97S probably benign Het
Other mutations in C4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:C4b APN 17 34,953,402 (GRCm39) missense probably damaging 1.00
IGL00433:C4b APN 17 34,961,015 (GRCm39) missense possibly damaging 0.75
IGL00471:C4b APN 17 34,953,403 (GRCm39) missense probably damaging 1.00
IGL00515:C4b APN 17 34,947,865 (GRCm39) missense probably damaging 1.00
IGL01599:C4b APN 17 34,961,993 (GRCm39) splice site probably benign
IGL01761:C4b APN 17 34,958,912 (GRCm39) missense possibly damaging 0.56
IGL02004:C4b APN 17 34,957,984 (GRCm39) unclassified probably benign
IGL02215:C4b APN 17 34,953,465 (GRCm39) missense probably damaging 1.00
IGL02517:C4b APN 17 34,953,382 (GRCm39) missense probably benign 0.01
IGL02926:C4b APN 17 34,949,686 (GRCm39) missense possibly damaging 0.95
IGL03031:C4b APN 17 34,950,104 (GRCm39) missense possibly damaging 0.47
IGL03057:C4b APN 17 34,956,738 (GRCm39) unclassified probably benign
IGL03165:C4b APN 17 34,958,929 (GRCm39) missense probably benign 0.13
IGL03380:C4b APN 17 34,959,260 (GRCm39) missense probably benign 0.01
Aspiration UTSW 17 34,953,416 (GRCm39) missense probably benign 0.00
Inspiration UTSW 17 34,951,140 (GRCm39) splice site probably null
Peroration UTSW 17 34,948,373 (GRCm39) critical splice donor site probably null
perspiration UTSW 17 34,948,805 (GRCm39) missense probably damaging 1.00
FR4548:C4b UTSW 17 34,959,971 (GRCm39) missense probably benign 0.00
R0064:C4b UTSW 17 34,957,830 (GRCm39) missense probably damaging 1.00
R0113:C4b UTSW 17 34,960,214 (GRCm39) missense probably damaging 0.98
R0143:C4b UTSW 17 34,953,193 (GRCm39) unclassified probably benign
R0254:C4b UTSW 17 34,953,750 (GRCm39) missense probably benign 0.00
R0320:C4b UTSW 17 34,952,135 (GRCm39) missense probably benign 0.01
R0391:C4b UTSW 17 34,954,588 (GRCm39) splice site probably benign
R0399:C4b UTSW 17 34,947,843 (GRCm39) missense probably damaging 1.00
R0467:C4b UTSW 17 34,955,101 (GRCm39) missense probably benign 0.01
R0549:C4b UTSW 17 34,954,389 (GRCm39) missense probably damaging 1.00
R0561:C4b UTSW 17 34,953,391 (GRCm39) missense probably damaging 0.99
R0662:C4b UTSW 17 34,949,862 (GRCm39) missense probably damaging 1.00
R0941:C4b UTSW 17 34,959,029 (GRCm39) missense probably benign
R1161:C4b UTSW 17 34,948,567 (GRCm39) missense probably damaging 1.00
R1169:C4b UTSW 17 34,961,946 (GRCm39) missense probably benign 0.14
R1186:C4b UTSW 17 34,955,283 (GRCm39) missense possibly damaging 0.47
R1310:C4b UTSW 17 34,948,567 (GRCm39) missense probably damaging 1.00
R1398:C4b UTSW 17 34,949,693 (GRCm39) unclassified probably benign
R1472:C4b UTSW 17 34,962,743 (GRCm39) nonsense probably null
R1496:C4b UTSW 17 34,958,995 (GRCm39) missense probably benign 0.30
R1544:C4b UTSW 17 34,957,941 (GRCm39) missense probably benign 0.13
R1588:C4b UTSW 17 34,959,999 (GRCm39) missense probably benign
R1645:C4b UTSW 17 34,959,571 (GRCm39) missense probably damaging 1.00
R1664:C4b UTSW 17 34,951,952 (GRCm39) missense probably damaging 1.00
R1678:C4b UTSW 17 34,962,624 (GRCm39) missense probably benign 0.05
R1710:C4b UTSW 17 34,962,638 (GRCm39) splice site probably benign
R1713:C4b UTSW 17 34,948,245 (GRCm39) splice site probably benign
R1770:C4b UTSW 17 34,955,901 (GRCm39) missense possibly damaging 0.78
R1859:C4b UTSW 17 34,954,527 (GRCm39) missense probably benign
R1924:C4b UTSW 17 34,948,631 (GRCm39) missense probably damaging 1.00
R2057:C4b UTSW 17 34,947,594 (GRCm39) missense probably damaging 1.00
R2060:C4b UTSW 17 34,955,075 (GRCm39) missense probably damaging 1.00
R2184:C4b UTSW 17 34,956,676 (GRCm39) missense probably benign 0.27
R2306:C4b UTSW 17 34,947,492 (GRCm39) missense probably benign 0.00
R2363:C4b UTSW 17 34,955,032 (GRCm39) splice site probably benign
R2365:C4b UTSW 17 34,955,032 (GRCm39) splice site probably benign
R2379:C4b UTSW 17 34,954,717 (GRCm39) missense possibly damaging 0.81
R2860:C4b UTSW 17 34,953,732 (GRCm39) missense probably damaging 0.99
R2861:C4b UTSW 17 34,953,732 (GRCm39) missense probably damaging 0.99
R3551:C4b UTSW 17 34,960,846 (GRCm39) missense possibly damaging 0.75
R3765:C4b UTSW 17 34,948,814 (GRCm39) missense probably damaging 0.98
R4157:C4b UTSW 17 34,961,829 (GRCm39) missense probably damaging 1.00
R4299:C4b UTSW 17 34,950,118 (GRCm39) missense possibly damaging 0.52
R4365:C4b UTSW 17 34,953,717 (GRCm39) missense possibly damaging 0.65
R4411:C4b UTSW 17 34,947,838 (GRCm39) missense probably damaging 1.00
R4613:C4b UTSW 17 34,953,525 (GRCm39) missense probably benign 0.12
R4784:C4b UTSW 17 34,952,380 (GRCm39) missense probably benign 0.00
R4790:C4b UTSW 17 34,953,117 (GRCm39) missense probably benign 0.01
R4831:C4b UTSW 17 34,955,864 (GRCm39) splice site probably null
R4879:C4b UTSW 17 34,962,621 (GRCm39) missense probably damaging 0.99
R5036:C4b UTSW 17 34,959,419 (GRCm39) critical splice acceptor site probably null
R5361:C4b UTSW 17 34,960,212 (GRCm39) missense probably benign 0.15
R5384:C4b UTSW 17 34,956,635 (GRCm39) missense possibly damaging 0.89
R5518:C4b UTSW 17 34,953,416 (GRCm39) missense probably benign 0.00
R5590:C4b UTSW 17 34,959,309 (GRCm39) missense probably damaging 0.98
R5643:C4b UTSW 17 34,961,391 (GRCm39) missense probably benign 0.01
R5644:C4b UTSW 17 34,961,391 (GRCm39) missense probably benign 0.01
R5833:C4b UTSW 17 34,949,647 (GRCm39) missense probably damaging 1.00
R5931:C4b UTSW 17 34,948,167 (GRCm39) missense probably damaging 0.99
R6178:C4b UTSW 17 34,952,380 (GRCm39) missense probably benign 0.00
R6209:C4b UTSW 17 34,960,061 (GRCm39) missense possibly damaging 0.93
R6225:C4b UTSW 17 34,957,848 (GRCm39) missense possibly damaging 0.64
R6518:C4b UTSW 17 34,953,179 (GRCm39) missense probably damaging 0.98
R6613:C4b UTSW 17 34,952,539 (GRCm39) missense probably damaging 0.99
R6781:C4b UTSW 17 34,961,928 (GRCm39) missense probably damaging 0.99
R6807:C4b UTSW 17 34,949,930 (GRCm39) missense probably benign 0.17
R6858:C4b UTSW 17 34,948,805 (GRCm39) missense probably damaging 1.00
R6962:C4b UTSW 17 34,951,140 (GRCm39) splice site probably null
R7068:C4b UTSW 17 34,952,451 (GRCm39) missense probably damaging 1.00
R7081:C4b UTSW 17 34,954,417 (GRCm39) missense probably benign 0.27
R7105:C4b UTSW 17 34,949,885 (GRCm39) missense possibly damaging 0.52
R7211:C4b UTSW 17 34,954,508 (GRCm39) missense possibly damaging 0.92
R7296:C4b UTSW 17 34,962,633 (GRCm39) missense probably damaging 1.00
R7314:C4b UTSW 17 34,959,330 (GRCm39) missense probably benign
R7330:C4b UTSW 17 34,949,446 (GRCm39) missense probably damaging 1.00
R7397:C4b UTSW 17 34,961,364 (GRCm39) missense possibly damaging 0.80
R7437:C4b UTSW 17 34,953,707 (GRCm39) missense probably benign 0.10
R7490:C4b UTSW 17 34,950,054 (GRCm39) nonsense probably null
R7597:C4b UTSW 17 34,958,649 (GRCm39) missense probably benign
R7633:C4b UTSW 17 34,948,373 (GRCm39) critical splice donor site probably null
R7900:C4b UTSW 17 34,958,751 (GRCm39) missense probably benign 0.03
R7910:C4b UTSW 17 34,959,326 (GRCm39) missense probably benign 0.00
R7923:C4b UTSW 17 34,961,354 (GRCm39) missense probably damaging 1.00
R7960:C4b UTSW 17 34,960,252 (GRCm39) splice site probably null
R8420:C4b UTSW 17 34,953,513 (GRCm39) missense probably damaging 0.97
R8467:C4b UTSW 17 34,951,787 (GRCm39) missense possibly damaging 0.51
R8558:C4b UTSW 17 34,955,541 (GRCm39) missense probably damaging 1.00
R8725:C4b UTSW 17 34,953,459 (GRCm39) missense probably damaging 1.00
R8727:C4b UTSW 17 34,953,459 (GRCm39) missense probably damaging 1.00
R8853:C4b UTSW 17 34,948,879 (GRCm39) missense possibly damaging 0.91
R8934:C4b UTSW 17 34,951,958 (GRCm39) missense possibly damaging 0.78
R8944:C4b UTSW 17 34,961,913 (GRCm39) missense probably benign 0.00
R8960:C4b UTSW 17 34,952,892 (GRCm39) missense probably damaging 1.00
R8982:C4b UTSW 17 34,953,338 (GRCm39) critical splice donor site probably null
R9104:C4b UTSW 17 34,948,233 (GRCm39) missense probably benign 0.39
R9114:C4b UTSW 17 34,948,404 (GRCm39) missense probably damaging 0.99
R9348:C4b UTSW 17 34,952,159 (GRCm39) missense probably benign 0.01
R9428:C4b UTSW 17 34,949,885 (GRCm39) missense possibly damaging 0.52
R9533:C4b UTSW 17 34,956,698 (GRCm39) nonsense probably null
R9591:C4b UTSW 17 34,957,929 (GRCm39) missense probably benign 0.00
R9678:C4b UTSW 17 34,960,763 (GRCm39) critical splice donor site probably null
Z1176:C4b UTSW 17 34,950,121 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTTGGTCAGCGTAAGGGCATAG -3'
(R):5'- GCAATGCAGGTGTGAACAC -3'

Sequencing Primer
(F):5'- CATAGGCTGTGATGGCGGC -3'
(R):5'- TGTGAACACGCTGGAGGC -3'
Posted On 2017-09-21