Incidental Mutation 'PIT4142001:Ndufs1'
ID486972
Institutional Source Beutler Lab
Gene Symbol Ndufs1
Ensembl Gene ENSMUSG00000025968
Gene NameNADH dehydrogenase (ubiquinone) Fe-S protein 1
Synonyms9930026A05Rik, 5830412M15Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4142001 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location63143596-63176833 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 63159748 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027111] [ENSMUST00000168099] [ENSMUST00000185847] [ENSMUST00000188370]
Predicted Effect probably benign
Transcript: ENSMUST00000027111
SMART Domains Protein: ENSMUSP00000027111
Gene: ENSMUSG00000025968

DomainStartEndE-ValueType
Pfam:Fer2_4 29 107 8.5e-20 PFAM
Pfam:Fer2 34 97 1e-11 PFAM
NADH-G_4Fe-4S_3 113 153 6.5e-19 SMART
Pfam:Molybdopterin 301 629 1e-76 PFAM
Pfam:NADH_dhqG_C 658 710 1.5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104692
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138611
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140612
Predicted Effect probably benign
Transcript: ENSMUST00000168099
SMART Domains Protein: ENSMUSP00000126621
Gene: ENSMUSG00000025968

DomainStartEndE-ValueType
Pfam:Fer2_4 29 107 4.3e-19 PFAM
Pfam:Fer2 34 97 1e-11 PFAM
NADH-G_4Fe-4S_3 113 153 6.5e-19 SMART
Pfam:Molybdopterin 301 629 1e-76 PFAM
Pfam:DUF1982 657 710 3.6e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185827
Predicted Effect probably benign
Transcript: ENSMUST00000185847
SMART Domains Protein: ENSMUSP00000141190
Gene: ENSMUSG00000025968

DomainStartEndE-ValueType
Pfam:Molybdopterin 1 60 5.7e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188370
SMART Domains Protein: ENSMUSP00000139664
Gene: ENSMUSG00000025968

DomainStartEndE-ValueType
Pfam:Fer2_4 29 96 1.1e-13 PFAM
Pfam:Fer2 34 127 1.2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188602
Meta Mutation Damage Score 0.1066 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 92% (105/114)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the complex I 75 kDa subunit family. Mammalian complex I is composed of 45 different subunits. It locates at the mitochondrial inner membrane. This protein has NADH dehydrogenase activity and oxidoreductase activity. It transfers electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone. This protein is the largest subunit of complex I and it is a component of the iron-sulfur (IP) fragment of the enzyme. It may form part of the active site crevice where NADH is oxidized. Mutations in this gene are associated with complex I deficiency. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530032D15Rik G A 1: 85,099,620 A75V probably benign Het
Abcg5 T G 17: 84,673,594 Y107S possibly damaging Het
Abhd8 T C 8: 71,461,855 E43G probably damaging Het
Ap1b1 T G 11: 5,040,360 L872W probably damaging Het
Arid1b T A 17: 5,339,243 M1688K probably damaging Het
AW822073 A G 10: 58,223,454 C493R probably benign Het
AW822073 G C 10: 58,223,456 P492R probably damaging Het
AW822073 G A 10: 58,224,314 probably benign Het
AW822073 C T 10: 58,224,882 E17K possibly damaging Het
Brca1 T C 11: 101,522,422 probably benign Het
C130026I21Rik A C 1: 85,245,674 probably benign Het
C4b C T 17: 34,733,701 V1151I probably benign Het
Card6 T A 15: 5,098,631 Q1094H unknown Het
Cd22 C A 7: 30,877,799 V28F possibly damaging Het
Cdc42bpa A T 1: 180,031,560 N109I probably damaging Het
Ces2b T C 8: 104,836,810 Y390H probably damaging Het
Clca4a T C 3: 144,968,311 Y221C probably damaging Het
Cntnap5a G T 1: 115,684,956 probably benign Het
Cyp4a10 C A 4: 115,524,875 H251Q probably damaging Het
Dcc A T 18: 71,384,226 probably null Het
Dnaaf5 A G 5: 139,185,518 K812E possibly damaging Het
Dnajc13 T C 9: 104,238,473 T46A probably damaging Het
Duxf3 C A 10: 58,231,168 C503F probably damaging Het
Duxf3 A C 10: 58,231,676 S27A probably benign Het
Duxf3 C A 10: 58,230,988 R563M probably damaging Het
Eps8l1 G A 7: 4,471,415 S295N probably benign Het
Etfdh C T 3: 79,609,867 S345N probably damaging Het
Fat3 A G 9: 15,992,118 probably null Het
G530012D18Rik T G 1: 85,577,204 probably benign Het
Gabra4 T C 5: 71,571,763 N558S probably damaging Het
Gm10471 A T 5: 26,086,487 F107Y probably benign Het
Gm10471 C G 5: 26,089,095 W28C probably damaging Het
Gm10718 A T 9: 3,024,417 T134S probably benign Het
Gm10722 T C 9: 3,001,350 L142S probably benign Het
Gm10800 A C 2: 98,666,548 F220C probably benign Het
Gm10800 T C 2: 98,666,818 R152G probably benign Het
Gm10800 C A 2: 98,666,905 V123F probably benign Het
Gm10800 CAAGAAAACTGAAAATCA C 2: 98,667,016 probably null Het
Gm10801 A G 2: 98,662,303 R23G probably benign Het
Gm11168 C T 9: 3,004,605 P49S probably benign Het
Gm21663 C T 5: 25,938,769 R185H probably benign Het
Gm21738 G A 14: 19,417,330 S66L probably benign Het
Gm4064 T A Y: 2,787,132 N228Y probably benign Het
Gm7682 A C 5: 94,446,784 K168Q probably benign Het
Gpr107 T A 2: 31,167,071 D58E probably benign Het
Gstm7 AAC A 3: 107,931,483 probably null Het
Hc C T 2: 35,031,821 probably benign Het
Hjurp A C 1: 88,266,046 V380G probably damaging Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTG T 1: 88,266,278 probably benign Het
Hjurp A G 1: 88,266,561 probably benign Het
Hjurp T C 1: 88,266,616 E190G probably benign Het
Hnrnpa2b1 A T 6: 51,464,109 M327K probably benign Het
Hoxa13 C G 6: 52,260,647 probably benign Het
Hoxa13 G C 6: 52,260,648 probably benign Het
Ifi206 A G 1: 173,481,164 V422A probably benign Het
Igf2bp3 A G 6: 49,117,383 V151A probably damaging Het
Ivl TTGC T 3: 92,572,301 probably benign Het
Kndc1 TC T 7: 139,923,776 probably null Het
Lig1 GC G 7: 13,305,924 probably null Het
Lrit1 A G 14: 37,062,041 Y442C probably damaging Het
Map3k21 C A 8: 125,937,308 P536H probably damaging Het
March10 T A 11: 105,390,520 Y313F probably benign Het
Mcm5 A G 8: 75,127,236 H706R probably benign Het
Mlycd T G 8: 119,410,460 I473S probably damaging Het
Muc4 C A 16: 32,754,529 H1468N probably benign Het
Muc4 C G 16: 32,755,676 probably benign Het
Muc4 T A 16: 32,755,684 probably benign Het
Myo5c T C 9: 75,283,948 V1088A probably benign Het
Nadk2 TG T 15: 9,100,143 probably null Het
Olfr732 A G 14: 50,281,327 *309Q probably null Het
Pak2 A T 16: 32,023,112 Y443N probably damaging Het
Pik3r6 T C 11: 68,527,105 I73T probably damaging Het
Pla2g4c A G 7: 13,343,391 E286G probably benign Het
Plekhn1 G A 4: 156,224,940 R196* probably null Het
Prdm10 T A 9: 31,325,767 D145E probably benign Het
Ptgis T C 2: 167,206,830 Y422C probably damaging Het
Ralgapb A G 2: 158,430,422 E132G probably benign Het
Rasgrf1 G A 9: 89,915,573 R168H possibly damaging Het
Rpl5 T C 5: 107,907,183 probably benign Het
Ryr2 T C 13: 11,707,796 K2603E probably damaging Het
Sap130 T C 18: 31,667,011 probably null Het
Scn5a C A 9: 119,486,258 D1794Y probably damaging Het
Sec31a A T 5: 100,407,275 S29T probably damaging Het
Selplg T G 5: 113,819,628 K206Q probably benign Het
Sfmbt1 A T 14: 30,816,757 probably null Het
Sirpb1a A T 3: 15,411,198 F180I probably benign Het
Slc44a4 A G 17: 34,921,275 I67V probably damaging Het
Sp110 C T 1: 85,586,250 R262Q probably benign Het
Sp110 T C 1: 85,586,254 R261G probably benign Het
Sp140 T A 1: 85,601,172 Y5N probably benign Het
Sp140 G C 1: 85,610,882 K113N probably benign Het
Sp140 A G 1: 85,643,221 S461G probably benign Het
Stab2 A T 10: 86,867,175 S1848R possibly damaging Het
Stat6 T C 10: 127,658,230 V642A possibly damaging Het
Tfam T C 10: 71,234,983 K63R possibly damaging Het
Trim2 T C 3: 84,190,857 N379S probably benign Het
Trp63 C T 16: 25,865,263 T300I probably damaging Het
Tymp C A 15: 89,376,345 W90L probably damaging Het
Ubr5 A G 15: 38,041,909 S148P probably damaging Het
Ugt1a10 TTCA T 1: 88,216,158 probably benign Het
Usp47 T C 7: 112,104,341 probably benign Het
Uvssa C T 5: 33,392,084 A363V probably benign Het
Vldlr T A 19: 27,234,869 D94E probably benign Het
Vmn1r3 C T 4: 3,184,691 M205I probably damaging Het
Vmn1r3 C T 4: 3,184,774 V178I probably benign Het
Vmn1r67 T A 7: 10,446,950 M47K probably benign Het
Vmn1r87 A T 7: 13,132,185 H58Q probably benign Het
Vmn1r89 A G 7: 13,219,588 T84A probably benign Het
Vmn2r109 T C 17: 20,554,577 probably null Het
Xirp2 T C 2: 67,519,362 probably benign Het
Zbtb2 A G 10: 4,369,493 S178P probably benign Het
Zfp534 C T 4: 147,675,574 E213K probably benign Het
Zfp534 C A 4: 147,678,313 D21Y probably benign Het
Zfp804b C T 5: 6,769,422 V1214I probably damaging Het
Zfp82 G T 7: 30,057,276 T63K probably damaging Het
Zfp986 C T 4: 145,898,943 R58C probably benign Het
Zfp992 C T 4: 146,466,112 P97S probably benign Het
Other mutations in Ndufs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01082:Ndufs1 APN 1 63164817 missense probably damaging 0.99
IGL01655:Ndufs1 APN 1 63151557 missense probably damaging 1.00
IGL02532:Ndufs1 APN 1 63170139 missense probably damaging 0.99
IGL02606:Ndufs1 APN 1 63159852 missense probably damaging 1.00
IGL02866:Ndufs1 APN 1 63147141 missense probably benign 0.00
IGL03036:Ndufs1 APN 1 63163696 nonsense probably null
IGL03209:Ndufs1 APN 1 63164737 missense probably damaging 1.00
R0165:Ndufs1 UTSW 1 63159748 critical splice donor site probably null
R0505:Ndufs1 UTSW 1 63143926 splice site probably benign
R1861:Ndufs1 UTSW 1 63147417 missense probably benign 0.17
R2294:Ndufs1 UTSW 1 63160996 missense probably damaging 1.00
R2872:Ndufs1 UTSW 1 63164723 splice site probably benign
R2873:Ndufs1 UTSW 1 63164723 splice site probably benign
R4092:Ndufs1 UTSW 1 63157246 missense possibly damaging 0.55
R4277:Ndufs1 UTSW 1 63170097 missense possibly damaging 0.84
R4782:Ndufs1 UTSW 1 63160949 missense probably damaging 1.00
R4799:Ndufs1 UTSW 1 63160949 missense probably damaging 1.00
R4993:Ndufs1 UTSW 1 63163776 missense probably benign
R5051:Ndufs1 UTSW 1 63164947 critical splice donor site probably null
R5412:Ndufs1 UTSW 1 63166349 missense possibly damaging 0.79
R5632:Ndufs1 UTSW 1 63150059 missense probably benign 0.00
R5705:Ndufs1 UTSW 1 63147158 missense probably benign 0.05
R5854:Ndufs1 UTSW 1 63147389 missense probably benign 0.05
R5919:Ndufs1 UTSW 1 63143832 makesense probably null
R6598:Ndufs1 UTSW 1 63164950 missense probably null 1.00
R7716:Ndufs1 UTSW 1 63152857 missense possibly damaging 0.95
R7744:Ndufs1 UTSW 1 63160940 missense possibly damaging 0.89
R7785:Ndufs1 UTSW 1 63147399 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAGCATATCTGAGATATGGCTCTC -3'
(R):5'- CCACCATCCCTGTGTTAGG -3'

Sequencing Primer
(F):5'- TTAATCTCAGCACTCAGTGGCAGAG -3'
(R):5'- GATGGACTAAAACGTCAAAG -3'
Posted On2017-09-21