Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4142001:Hc'

486975

Institutional Source

Beutler Lab

Gene Symbol

Ensembl Gene

ENSMUSG00000026874

Gene Name

hemolytic complement

Synonyms

He, C5, C5a

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.487) question?

Stock #

PIT4142001 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

34983331-35061438 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

C to T at 35031821 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000028233 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028233]

AlphaFold

P06684

PDB Structure

Crystal structure of the mouse C5a anaphylatoxin [X-RAY DIFFRACTION]
Crystal structure of the mouse C5a-desArg anaphylatoxin [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000028233

SMART Domains

Protein: ENSMUSP00000028233
Gene: ENSMUSG00000026874

Domain	Start	End	E-Value	Type
Pfam:A2M_N	125	219	1.8e-15	PFAM
A2M_N_2	465	612	9.83e-34	SMART
ANATO	702	736	4.73e-12	SMART
A2M	776	863	2.44e-29	SMART
Pfam:A2M_comp	1055	1306	2.3e-68	PFAM
A2M_recep	1423	1513	7.29e-28	SMART
C345C	1553	1665	1.51e-35	SMART

Coding Region Coverage

1x: 0.0%
3x: 0.0%
10x: 0.0%
20x: 0.0%

Validation Efficiency

92% (105/114)

MGI Phenotype

FUNCTION: This gene encodes a component of the complement system, a part of the innate immune system that plays an important role in inflammation, host homeostasis, and host defense against pathogens. The encoded preproprotein is proteolytically processed to generate multiple protein products, including the C5 alpha chain, C5 beta chain, C5a anaphylatoxin and C5b. The C5 protein is comprised of the alpha and beta chains, which are linked by a disulfide bridge. Cleavage of the alpha chain by a convertase enzyme results in the formation of the C5a anaphylatoxin, which possesses potent spasmogenic and chemotactic activity, and the C5b macromolecular cleavage product, a subunit of the membrane attack complex (MAC). Mice with a homozygous mutation in this gene exhibit impaired bone fracture healing and an enhanced inflammatory response in an allergic lung disease model. [provided by RefSeq, Nov 2015]
PHENOTYPE: Macrophage from mice homozygous for disruptions of this gene do not secrete complement C5.

The 2 bp deletion found in A/J and AKR/J strains is associated with susceptibility to allergen-induced bronchial hyperresponsiveness and is a candidate for QTL Abhr2.

[provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 117 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A530032D15Rik	G	A	1: 85,099,620	A75V	probably benign	Het
Abcg5	T	G	17: 84,673,594	Y107S	possibly damaging	Het
Abhd8	T	C	8: 71,461,855	E43G	probably damaging	Het
Ap1b1	T	G	11: 5,040,360	L872W	probably damaging	Het
Arid1b	T	A	17: 5,339,243	M1688K	probably damaging	Het
AW822073	A	G	10: 58,223,454	C493R	probably benign	Het
AW822073	G	C	10: 58,223,456	P492R	probably damaging	Het
AW822073	G	A	10: 58,224,314		probably benign	Het
AW822073	C	T	10: 58,224,882	E17K	possibly damaging	Het
Brca1	T	C	11: 101,522,422		probably benign	Het
C130026I21Rik	A	C	1: 85,245,674		probably benign	Het
C4b	C	T	17: 34,733,701	V1151I	probably benign	Het
Card6	T	A	15: 5,098,631	Q1094H	unknown	Het
Cd22	C	A	7: 30,877,799	V28F	possibly damaging	Het
Cdc42bpa	A	T	1: 180,031,560	N109I	probably damaging	Het
Ces2b	T	C	8: 104,836,810	Y390H	probably damaging	Het
Clca4a	T	C	3: 144,968,311	Y221C	probably damaging	Het
Cntnap5a	G	T	1: 115,684,956		probably benign	Het
Cyp4a10	C	A	4: 115,524,875	H251Q	probably damaging	Het
Dcc	A	T	18: 71,384,226		probably null	Het
Dnaaf5	A	G	5: 139,185,518	K812E	possibly damaging	Het
Dnajc13	T	C	9: 104,238,473	T46A	probably damaging	Het
Duxf3	C	A	10: 58,231,168	C503F	probably damaging	Het
Duxf3	A	C	10: 58,231,676	S27A	probably benign	Het
Duxf3	C	A	10: 58,230,988	R563M	probably damaging	Het
Eps8l1	G	A	7: 4,471,415	S295N	probably benign	Het
Etfdh	C	T	3: 79,609,867	S345N	probably damaging	Het
Fat3	A	G	9: 15,992,118		probably null	Het
G530012D18Rik	T	G	1: 85,577,204		probably benign	Het
Gabra4	T	C	5: 71,571,763	N558S	probably damaging	Het
Gm10471	A	T	5: 26,086,487	F107Y	probably benign	Het
Gm10471	C	G	5: 26,089,095	W28C	probably damaging	Het
Gm10718	A	T	9: 3,024,417	T134S	probably benign	Het
Gm10722	T	C	9: 3,001,350	L142S	probably benign	Het
Gm10800	A	C	2: 98,666,548	F220C	probably benign	Het
Gm10800	T	C	2: 98,666,818	R152G	probably benign	Het
Gm10800	C	A	2: 98,666,905	V123F	probably benign	Het
Gm10800	CAAGAAAACTGAAAATCA	C	2: 98,667,016		probably null	Het
Gm10801	A	G	2: 98,662,303	R23G	probably benign	Het
Gm11168	C	T	9: 3,004,605	P49S	probably benign	Het
Gm21663	C	T	5: 25,938,769	R185H	probably benign	Het
Gm21738	G	A	14: 19,417,330	S66L	probably benign	Het
Gm4064	T	A	Y: 2,787,132	N228Y	probably benign	Het
Gm7682	A	C	5: 94,446,784	K168Q	probably benign	Het
Gpr107	T	A	2: 31,167,071	D58E	probably benign	Het
Gstm7	AAC	A	3: 107,931,483		probably null	Het
Hjurp	A	C	1: 88,266,046	V380G	probably damaging	Het
Hjurp	TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTG	T	1: 88,266,278		probably benign	Het
Hjurp	A	G	1: 88,266,561		probably benign	Het
Hjurp	T	C	1: 88,266,616	E190G	probably benign	Het
Hnrnpa2b1	A	T	6: 51,464,109	M327K	probably benign	Het
Hoxa13	C	G	6: 52,260,647		probably benign	Het
Hoxa13	G	C	6: 52,260,648		probably benign	Het
Ifi206	A	G	1: 173,481,164	V422A	probably benign	Het
Igf2bp3	A	G	6: 49,117,383	V151A	probably damaging	Het
Ivl	TTGC	T	3: 92,572,301		probably benign	Het
Kndc1	TC	T	7: 139,923,776		probably null	Het
Lig1	GC	G	7: 13,305,924		probably null	Het
Lrit1	A	G	14: 37,062,041	Y442C	probably damaging	Het
Map3k21	C	A	8: 125,937,308	P536H	probably damaging	Het
March10	T	A	11: 105,390,520	Y313F	probably benign	Het
Mcm5	A	G	8: 75,127,236	H706R	probably benign	Het
Mlycd	T	G	8: 119,410,460	I473S	probably damaging	Het
Muc4	C	A	16: 32,754,529	H1468N	probably benign	Het
Muc4	C	G	16: 32,755,676		probably benign	Het
Muc4	T	A	16: 32,755,684		probably benign	Het
Myo5c	T	C	9: 75,283,948	V1088A	probably benign	Het
Nadk2	TG	T	15: 9,100,143		probably null	Het
Ndufs1	A	G	1: 63,159,748		probably benign	Het
Olfr732	A	G	14: 50,281,327	*309Q	probably null	Het
Pak2	A	T	16: 32,023,112	Y443N	probably damaging	Het
Pik3r6	T	C	11: 68,527,105	I73T	probably damaging	Het
Pla2g4c	A	G	7: 13,343,391	E286G	probably benign	Het
Plekhn1	G	A	4: 156,224,940	R196*	probably null	Het
Prdm10	T	A	9: 31,325,767	D145E	probably benign	Het
Ptgis	T	C	2: 167,206,830	Y422C	probably damaging	Het
Ralgapb	A	G	2: 158,430,422	E132G	probably benign	Het
Rasgrf1	G	A	9: 89,915,573	R168H	possibly damaging	Het
Rpl5	T	C	5: 107,907,183		probably benign	Het
Ryr2	T	C	13: 11,707,796	K2603E	probably damaging	Het
Sap130	T	C	18: 31,667,011		probably null	Het
Scn5a	C	A	9: 119,486,258	D1794Y	probably damaging	Het
Sec31a	A	T	5: 100,407,275	S29T	probably damaging	Het
Selplg	T	G	5: 113,819,628	K206Q	probably benign	Het
Sfmbt1	A	T	14: 30,816,757		probably null	Het
Sirpb1a	A	T	3: 15,411,198	F180I	probably benign	Het
Slc44a4	A	G	17: 34,921,275	I67V	probably damaging	Het
Sp110	C	T	1: 85,586,250	R262Q	probably benign	Het
Sp110	T	C	1: 85,586,254	R261G	probably benign	Het
Sp140	T	A	1: 85,601,172	Y5N	probably benign	Het
Sp140	G	C	1: 85,610,882	K113N	probably benign	Het
Sp140	A	G	1: 85,643,221	S461G	probably benign	Het
Stab2	A	T	10: 86,867,175	S1848R	possibly damaging	Het
Stat6	T	C	10: 127,658,230	V642A	possibly damaging	Het
Tfam	T	C	10: 71,234,983	K63R	possibly damaging	Het
Trim2	T	C	3: 84,190,857	N379S	probably benign	Het
Trp63	C	T	16: 25,865,263	T300I	probably damaging	Het
Tymp	C	A	15: 89,376,345	W90L	probably damaging	Het
Ubr5	A	G	15: 38,041,909	S148P		Het
Ugt1a10	TTCA	T	1: 88,216,158		probably benign	Het
Usp47	T	C	7: 112,104,341		probably benign	Het
Uvssa	C	T	5: 33,392,084	A363V	probably benign	Het
Vldlr	T	A	19: 27,234,869	D94E	probably benign	Het
Vmn1r3	C	T	4: 3,184,691	M205I	probably damaging	Het
Vmn1r3	C	T	4: 3,184,774	V178I	probably benign	Het
Vmn1r67	T	A	7: 10,446,950	M47K	probably benign	Het
Vmn1r87	A	T	7: 13,132,185	H58Q	probably benign	Het
Vmn1r89	A	G	7: 13,219,588	T84A	probably benign	Het
Vmn2r109	T	C	17: 20,554,577		probably null	Het
Xirp2	T	C	2: 67,519,362		probably benign	Het
Zbtb2	A	G	10: 4,369,493	S178P	probably benign	Het
Zfp534	C	T	4: 147,675,574	E213K	probably benign	Het
Zfp534	C	A	4: 147,678,313	D21Y	probably benign	Het
Zfp804b	C	T	5: 6,769,422	V1214I	probably damaging	Het
Zfp82	G	T	7: 30,057,276	T63K	probably damaging	Het
Zfp986	C	T	4: 145,898,943	R58C	probably benign	Het
Zfp992	C	T	4: 146,466,112	P97S	probably benign	Het

Other mutations in Hc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00694:Hc	APN	2	34991629	missense	probably benign	0.00
IGL00922:Hc	APN	2	34991668	missense	probably damaging	1.00
IGL01523:Hc	APN	2	35039238	missense	probably benign	0.04
IGL01746:Hc	APN	2	35057326	missense	probably damaging	0.98
IGL01793:Hc	APN	2	35028190	missense	probably damaging	1.00
IGL01972:Hc	APN	2	34983772	missense	probably damaging	1.00
IGL02037:Hc	APN	2	35013519	missense	probably benign	0.16
IGL02048:Hc	APN	2	34996027	missense	probably benign	0.00
IGL02227:Hc	APN	2	35009911	intron	probably benign
IGL02230:Hc	APN	2	35013670	missense	probably benign
IGL02254:Hc	APN	2	34984824	missense	probably damaging	1.00
IGL02363:Hc	APN	2	35000835	missense	probably benign
IGL02650:Hc	APN	2	35000874	missense	possibly damaging	0.49
IGL03053:Hc	APN	2	35024198	missense	probably benign	0.07
IGL03168:Hc	APN	2	35024198	missense	probably benign	0.07
IGL03341:Hc	APN	2	35003377	missense	probably damaging	0.98
PIT4378001:Hc	UTSW	2	35031864	missense	probably benign	0.13
PIT4508001:Hc	UTSW	2	34984804	missense	probably damaging	0.96
PIT4812001:Hc	UTSW	2	35029452	missense	probably benign	0.16
R0025:Hc	UTSW	2	34986292	missense	probably damaging	1.00
R0053:Hc	UTSW	2	35057275	missense	probably benign	0.32
R0197:Hc	UTSW	2	34984750	missense	probably damaging	1.00
R0218:Hc	UTSW	2	35028074	missense	probably damaging	1.00
R0242:Hc	UTSW	2	35036154	splice site	probably benign
R0496:Hc	UTSW	2	35013571	missense	probably damaging	1.00
R1205:Hc	UTSW	2	35003524	missense	possibly damaging	0.50
R1468:Hc	UTSW	2	34983807	nonsense	probably null
R1468:Hc	UTSW	2	34983807	nonsense	probably null
R1574:Hc	UTSW	2	35000765	intron	probably benign
R1610:Hc	UTSW	2	35006161	missense	probably benign	0.44
R1640:Hc	UTSW	2	35057324	nonsense	probably null
R1887:Hc	UTSW	2	35034611	missense	probably benign
R1920:Hc	UTSW	2	35029395	splice site	probably benign
R2018:Hc	UTSW	2	35013528	missense	probably damaging	1.00
R2019:Hc	UTSW	2	35013528	missense	probably damaging	1.00
R2151:Hc	UTSW	2	34991103	intron	probably benign
R2366:Hc	UTSW	2	35013636	missense	probably benign
R4093:Hc	UTSW	2	34983807	nonsense	probably null
R4288:Hc	UTSW	2	35030402	missense	probably damaging	0.98
R4501:Hc	UTSW	2	34997476	splice site	probably null
R4502:Hc	UTSW	2	35006252	missense	probably benign	0.00
R4508:Hc	UTSW	2	35013065	missense	possibly damaging	0.94
R4583:Hc	UTSW	2	35028177	missense	probably benign	0.00
R4686:Hc	UTSW	2	35039248	missense	possibly damaging	0.49
R4776:Hc	UTSW	2	35039734	missense	probably benign	0.12
R4846:Hc	UTSW	2	35019670	missense	probably benign	0.00
R5032:Hc	UTSW	2	35013532	missense	probably benign	0.07
R5089:Hc	UTSW	2	35024890	missense	probably benign	0.01
R5289:Hc	UTSW	2	34996014	critical splice donor site	probably null
R5347:Hc	UTSW	2	35037624	missense	probably benign	0.04
R5356:Hc	UTSW	2	34994995	missense	probably benign	0.00
R5379:Hc	UTSW	2	34991065	missense	probably damaging	1.00
R5403:Hc	UTSW	2	35057434	missense	probably damaging	1.00
R5418:Hc	UTSW	2	35008183	critical splice donor site	probably null
R5450:Hc	UTSW	2	35013038	missense	possibly damaging	0.67
R5494:Hc	UTSW	2	35003539	splice site	probably null
R5713:Hc	UTSW	2	35013531	missense	probably damaging	0.99
R5898:Hc	UTSW	2	34997437	missense	probably benign	0.06
R5925:Hc	UTSW	2	35030450	missense	possibly damaging	0.92
R5942:Hc	UTSW	2	35028125	nonsense	probably null
R5991:Hc	UTSW	2	35006105	missense	possibly damaging	0.91
R6036:Hc	UTSW	2	35039684	missense	probably benign	0.00
R6036:Hc	UTSW	2	35039684	missense	probably benign	0.00
R6115:Hc	UTSW	2	35013038	missense	probably damaging	1.00
R6234:Hc	UTSW	2	35028046	missense	probably benign
R6264:Hc	UTSW	2	35006273	critical splice acceptor site	probably null
R6313:Hc	UTSW	2	34989839	splice site	probably null
R6525:Hc	UTSW	2	34991224	missense	probably benign	0.06
R6577:Hc	UTSW	2	35032126	missense	probably benign	0.00
R6601:Hc	UTSW	2	35045894	missense	probably benign	0.03
R6916:Hc	UTSW	2	35010032	nonsense	probably null
R7108:Hc	UTSW	2	35039694	missense	probably benign	0.03
R7143:Hc	UTSW	2	35050438	missense	probably benign	0.00
R7388:Hc	UTSW	2	34984847	splice site	probably null
R7468:Hc	UTSW	2	35028051	missense	probably benign	0.00
R7504:Hc	UTSW	2	35061319	missense	not run
R7521:Hc	UTSW	2	35045332	missense	possibly damaging	0.80
R7582:Hc	UTSW	2	34991266	missense	possibly damaging	0.70
R7596:Hc	UTSW	2	35000847	missense	probably damaging	0.96
R7599:Hc	UTSW	2	35050419	missense	probably damaging	1.00
R7692:Hc	UTSW	2	35024149	missense	probably damaging	1.00
R7853:Hc	UTSW	2	35010033	missense	probably damaging	1.00
R7877:Hc	UTSW	2	34997399	nonsense	probably null
R8329:Hc	UTSW	2	35012898	splice site	probably null
R8375:Hc	UTSW	2	34983719	missense	probably benign	0.32
R8477:Hc	UTSW	2	34989170	missense	probably damaging	1.00
R8810:Hc	UTSW	2	35019523	missense	probably benign	0.06
R8888:Hc	UTSW	2	35000849	missense	probably benign	0.00
R8895:Hc	UTSW	2	35000849	missense	probably benign	0.00
R8968:Hc	UTSW	2	35032305	missense	possibly damaging	0.91
R8969:Hc	UTSW	2	35019463	critical splice donor site	probably null
R9146:Hc	UTSW	2	35034559	missense	probably damaging	1.00
R9218:Hc	UTSW	2	35032191	missense	probably damaging	1.00
R9340:Hc	UTSW	2	34986282	missense	probably damaging	0.99
R9396:Hc	UTSW	2	35037603	nonsense	probably null
R9569:Hc	UTSW	2	35036347	missense	probably benign	0.00
R9576:Hc	UTSW	2	34983755	missense	probably benign	0.01
R9706:Hc	UTSW	2	35024184	missense	probably damaging	1.00
X0066:Hc	UTSW	2	34983711	missense	probably damaging	1.00
Z1088:Hc	UTSW	2	35008249	missense	possibly damaging	0.94
Z1088:Hc	UTSW	2	35029470	missense	probably benign	0.02
Z1176:Hc	UTSW	2	35006273	critical splice acceptor site	probably null
Z1177:Hc	UTSW	2	35013610	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTGGATGACCCGTGCTTTAG -3'
(R):5'- AATGCTCTCTTAGGTCCATCTG -3'

Sequencing Primer
(F):5'- GTGAGCTATAAGACCCTAGTCCTAG -3'
(R):5'- CTGTCTCCAGATGAATATGTGTATTC -3'

Posted On

2017-09-21