Incidental Mutation 'PIT4142001:Hc'
ID486975
Institutional Source Beutler Lab
Gene Symbol Hc
Ensembl Gene ENSMUSG00000026874
Gene Namehemolytic complement
SynonymsHe, C5, C5a
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.668) question?
Stock #PIT4142001 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location34983331-35061438 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 35031821 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028233]
PDB Structure
Crystal structure of the mouse C5a anaphylatoxin [X-RAY DIFFRACTION]
Crystal structure of the mouse C5a-desArg anaphylatoxin [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000028233
SMART Domains Protein: ENSMUSP00000028233
Gene: ENSMUSG00000026874

DomainStartEndE-ValueType
Pfam:A2M_N 125 219 1.8e-15 PFAM
A2M_N_2 465 612 9.83e-34 SMART
ANATO 702 736 4.73e-12 SMART
A2M 776 863 2.44e-29 SMART
Pfam:A2M_comp 1055 1306 2.3e-68 PFAM
A2M_recep 1423 1513 7.29e-28 SMART
C345C 1553 1665 1.51e-35 SMART
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 92% (105/114)
MGI Phenotype FUNCTION: This gene encodes a component of the complement system, a part of the innate immune system that plays an important role in inflammation, host homeostasis, and host defense against pathogens. The encoded preproprotein is proteolytically processed to generate multiple protein products, including the C5 alpha chain, C5 beta chain, C5a anaphylatoxin and C5b. The C5 protein is comprised of the alpha and beta chains, which are linked by a disulfide bridge. Cleavage of the alpha chain by a convertase enzyme results in the formation of the C5a anaphylatoxin, which possesses potent spasmogenic and chemotactic activity, and the C5b macromolecular cleavage product, a subunit of the membrane attack complex (MAC). Mice with a homozygous mutation in this gene exhibit impaired bone fracture healing and an enhanced inflammatory response in an allergic lung disease model. [provided by RefSeq, Nov 2015]
PHENOTYPE: Macrophage from mice homozygous for disruptions of this gene do not secrete complement C5.

The 2 bp deletion found in A/J and AKR/J strains is associated with susceptibility to allergen-induced bronchial hyperresponsiveness and is a candidate for QTL Abhr2.

[provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530032D15Rik G A 1: 85,099,620 A75V probably benign Het
Abcg5 T G 17: 84,673,594 Y107S possibly damaging Het
Abhd8 T C 8: 71,461,855 E43G probably damaging Het
Ap1b1 T G 11: 5,040,360 L872W probably damaging Het
Arid1b T A 17: 5,339,243 M1688K probably damaging Het
AW822073 G C 10: 58,223,456 P492R probably damaging Het
AW822073 C T 10: 58,224,882 E17K possibly damaging Het
AW822073 A G 10: 58,223,454 C493R probably benign Het
AW822073 G A 10: 58,224,314 probably benign Het
Brca1 T C 11: 101,522,422 probably benign Het
C130026I21Rik A C 1: 85,245,674 probably benign Het
C4b C T 17: 34,733,701 V1151I probably benign Het
Card6 T A 15: 5,098,631 Q1094H unknown Het
Cd22 C A 7: 30,877,799 V28F possibly damaging Het
Cdc42bpa A T 1: 180,031,560 N109I probably damaging Het
Ces2b T C 8: 104,836,810 Y390H probably damaging Het
Clca4a T C 3: 144,968,311 Y221C probably damaging Het
Cntnap5a G T 1: 115,684,956 probably benign Het
Cyp4a10 C A 4: 115,524,875 H251Q probably damaging Het
Dcc A T 18: 71,384,226 probably null Het
Dnaaf5 A G 5: 139,185,518 K812E possibly damaging Het
Dnajc13 T C 9: 104,238,473 T46A probably damaging Het
Duxf3 C A 10: 58,231,168 C503F probably damaging Het
Duxf3 C A 10: 58,230,988 R563M probably damaging Het
Duxf3 A C 10: 58,231,676 S27A probably benign Het
Eps8l1 G A 7: 4,471,415 S295N probably benign Het
Etfdh C T 3: 79,609,867 S345N probably damaging Het
Fat3 A G 9: 15,992,118 probably null Het
G530012D18Rik T G 1: 85,577,204 probably benign Het
Gabra4 T C 5: 71,571,763 N558S probably damaging Het
Gm10471 C G 5: 26,089,095 W28C probably damaging Het
Gm10471 A T 5: 26,086,487 F107Y probably benign Het
Gm10718 A T 9: 3,024,417 T134S probably benign Het
Gm10722 T C 9: 3,001,350 L142S probably benign Het
Gm10800 CAAGAAAACTGAAAATCA C 2: 98,667,016 probably null Het
Gm10800 A C 2: 98,666,548 F220C probably benign Het
Gm10800 T C 2: 98,666,818 R152G probably benign Het
Gm10800 C A 2: 98,666,905 V123F probably benign Het
Gm10801 A G 2: 98,662,303 R23G probably benign Het
Gm11168 C T 9: 3,004,605 P49S probably benign Het
Gm21663 C T 5: 25,938,769 R185H probably benign Het
Gm21738 G A 14: 19,417,330 S66L probably benign Het
Gm4064 T A Y: 2,787,132 N228Y probably benign Het
Gm7682 A C 5: 94,446,784 K168Q probably benign Het
Gpr107 T A 2: 31,167,071 D58E probably benign Het
Gstm7 AAC A 3: 107,931,483 probably null Het
Hjurp A C 1: 88,266,046 V380G probably damaging Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTG T 1: 88,266,278 probably benign Het
Hjurp A G 1: 88,266,561 probably benign Het
Hjurp T C 1: 88,266,616 E190G probably benign Het
Hnrnpa2b1 A T 6: 51,464,109 M327K probably benign Het
Hoxa13 C G 6: 52,260,647 probably benign Het
Hoxa13 G C 6: 52,260,648 probably benign Het
Ifi206 A G 1: 173,481,164 V422A probably benign Het
Igf2bp3 A G 6: 49,117,383 V151A probably damaging Het
Ivl TTGC T 3: 92,572,301 probably benign Het
Kndc1 TC T 7: 139,923,776 probably null Het
Lig1 GC G 7: 13,305,924 probably null Het
Lrit1 A G 14: 37,062,041 Y442C probably damaging Het
Map3k21 C A 8: 125,937,308 P536H probably damaging Het
March10 T A 11: 105,390,520 Y313F probably benign Het
Mcm5 A G 8: 75,127,236 H706R probably benign Het
Mlycd T G 8: 119,410,460 I473S probably damaging Het
Muc4 C A 16: 32,754,529 H1468N probably benign Het
Muc4 C G 16: 32,755,676 probably benign Het
Muc4 T A 16: 32,755,684 probably benign Het
Myo5c T C 9: 75,283,948 V1088A probably benign Het
Nadk2 TG T 15: 9,100,143 probably null Het
Ndufs1 A G 1: 63,159,748 probably benign Het
Olfr732 A G 14: 50,281,327 *309Q probably null Het
Pak2 A T 16: 32,023,112 Y443N probably damaging Het
Pik3r6 T C 11: 68,527,105 I73T probably damaging Het
Pla2g4c A G 7: 13,343,391 E286G probably benign Het
Plekhn1 G A 4: 156,224,940 R196* probably null Het
Prdm10 T A 9: 31,325,767 D145E probably benign Het
Ptgis T C 2: 167,206,830 Y422C probably damaging Het
Ralgapb A G 2: 158,430,422 E132G probably benign Het
Rasgrf1 G A 9: 89,915,573 R168H possibly damaging Het
Rpl5 T C 5: 107,907,183 probably benign Het
Ryr2 T C 13: 11,707,796 K2603E probably damaging Het
Sap130 T C 18: 31,667,011 probably null Het
Scn5a C A 9: 119,486,258 D1794Y probably damaging Het
Sec31a A T 5: 100,407,275 S29T probably damaging Het
Selplg T G 5: 113,819,628 K206Q probably benign Het
Sfmbt1 A T 14: 30,816,757 probably null Het
Sirpb1a A T 3: 15,411,198 F180I probably benign Het
Slc44a4 A G 17: 34,921,275 I67V probably damaging Het
Sp110 C T 1: 85,586,250 R262Q probably benign Het
Sp110 T C 1: 85,586,254 R261G probably benign Het
Sp140 T A 1: 85,601,172 Y5N probably benign Het
Sp140 G C 1: 85,610,882 K113N probably benign Het
Sp140 A G 1: 85,643,221 S461G probably benign Het
Stab2 A T 10: 86,867,175 S1848R possibly damaging Het
Stat6 T C 10: 127,658,230 V642A possibly damaging Het
Tfam T C 10: 71,234,983 K63R possibly damaging Het
Trim2 T C 3: 84,190,857 N379S probably benign Het
Trp63 C T 16: 25,865,263 T300I probably damaging Het
Tymp C A 15: 89,376,345 W90L probably damaging Het
Ubr5 A G 15: 38,041,909 S148P probably damaging Het
Ugt1a10 TTCA T 1: 88,216,158 probably benign Het
Usp47 T C 7: 112,104,341 probably benign Het
Uvssa C T 5: 33,392,084 A363V probably benign Het
Vldlr T A 19: 27,234,869 D94E probably benign Het
Vmn1r3 C T 4: 3,184,774 V178I probably benign Het
Vmn1r3 C T 4: 3,184,691 M205I probably damaging Het
Vmn1r67 T A 7: 10,446,950 M47K probably benign Het
Vmn1r87 A T 7: 13,132,185 H58Q probably benign Het
Vmn1r89 A G 7: 13,219,588 T84A probably benign Het
Vmn2r109 T C 17: 20,554,577 probably null Het
Xirp2 T C 2: 67,519,362 probably benign Het
Zbtb2 A G 10: 4,369,493 S178P probably benign Het
Zfp534 C T 4: 147,675,574 E213K probably benign Het
Zfp534 C A 4: 147,678,313 D21Y probably benign Het
Zfp804b C T 5: 6,769,422 V1214I probably damaging Het
Zfp82 G T 7: 30,057,276 T63K probably damaging Het
Zfp986 C T 4: 145,898,943 R58C probably benign Het
Zfp992 C T 4: 146,466,112 P97S probably benign Het
Other mutations in Hc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Hc APN 2 34991629 missense probably benign 0.00
IGL00922:Hc APN 2 34991668 missense probably damaging 1.00
IGL01523:Hc APN 2 35039238 missense probably benign 0.04
IGL01746:Hc APN 2 35057326 missense probably damaging 0.98
IGL01793:Hc APN 2 35028190 missense probably damaging 1.00
IGL01972:Hc APN 2 34983772 missense probably damaging 1.00
IGL02037:Hc APN 2 35013519 missense probably benign 0.16
IGL02048:Hc APN 2 34996027 missense probably benign 0.00
IGL02227:Hc APN 2 35009911 intron probably benign
IGL02230:Hc APN 2 35013670 missense probably benign
IGL02254:Hc APN 2 34984824 missense probably damaging 1.00
IGL02363:Hc APN 2 35000835 missense probably benign
IGL02650:Hc APN 2 35000874 missense possibly damaging 0.49
IGL03053:Hc APN 2 35024198 missense probably benign 0.07
IGL03168:Hc APN 2 35024198 missense probably benign 0.07
IGL03341:Hc APN 2 35003377 missense probably damaging 0.98
PIT4378001:Hc UTSW 2 35031864 missense probably benign 0.13
PIT4508001:Hc UTSW 2 34984804 missense probably damaging 0.96
PIT4812001:Hc UTSW 2 35029452 missense probably benign 0.16
R0025:Hc UTSW 2 34986292 missense probably damaging 1.00
R0053:Hc UTSW 2 35057275 missense probably benign 0.32
R0197:Hc UTSW 2 34984750 missense probably damaging 1.00
R0218:Hc UTSW 2 35028074 missense probably damaging 1.00
R0242:Hc UTSW 2 35036154 splice site probably benign
R0496:Hc UTSW 2 35013571 missense probably damaging 1.00
R1205:Hc UTSW 2 35003524 missense possibly damaging 0.50
R1468:Hc UTSW 2 34983807 nonsense probably null
R1468:Hc UTSW 2 34983807 nonsense probably null
R1574:Hc UTSW 2 35000765 intron probably benign
R1610:Hc UTSW 2 35006161 missense probably benign 0.44
R1640:Hc UTSW 2 35057324 nonsense probably null
R1887:Hc UTSW 2 35034611 missense probably benign
R1920:Hc UTSW 2 35029395 splice site probably benign
R2018:Hc UTSW 2 35013528 missense probably damaging 1.00
R2019:Hc UTSW 2 35013528 missense probably damaging 1.00
R2151:Hc UTSW 2 34991103 intron probably benign
R2366:Hc UTSW 2 35013636 missense probably benign
R4093:Hc UTSW 2 34983807 nonsense probably null
R4288:Hc UTSW 2 35030402 missense probably damaging 0.98
R4501:Hc UTSW 2 34997476 splice site probably null
R4502:Hc UTSW 2 35006252 missense probably benign 0.00
R4508:Hc UTSW 2 35013065 missense possibly damaging 0.94
R4583:Hc UTSW 2 35028177 missense probably benign 0.00
R4686:Hc UTSW 2 35039248 missense possibly damaging 0.49
R4776:Hc UTSW 2 35039734 missense probably benign 0.12
R4846:Hc UTSW 2 35019670 missense probably benign 0.00
R5032:Hc UTSW 2 35013532 missense probably benign 0.07
R5089:Hc UTSW 2 35024890 missense probably benign 0.01
R5289:Hc UTSW 2 34996014 critical splice donor site probably null
R5347:Hc UTSW 2 35037624 missense probably benign 0.04
R5356:Hc UTSW 2 34994995 missense probably benign 0.00
R5379:Hc UTSW 2 34991065 missense probably damaging 1.00
R5403:Hc UTSW 2 35057434 missense probably damaging 1.00
R5418:Hc UTSW 2 35008183 critical splice donor site probably null
R5450:Hc UTSW 2 35013038 missense possibly damaging 0.67
R5494:Hc UTSW 2 35003539 splice site probably null
R5713:Hc UTSW 2 35013531 missense probably damaging 0.99
R5898:Hc UTSW 2 34997437 missense probably benign 0.06
R5925:Hc UTSW 2 35030450 missense possibly damaging 0.92
R5942:Hc UTSW 2 35028125 nonsense probably null
R5991:Hc UTSW 2 35006105 missense possibly damaging 0.91
R6036:Hc UTSW 2 35039684 missense probably benign 0.00
R6036:Hc UTSW 2 35039684 missense probably benign 0.00
R6115:Hc UTSW 2 35013038 missense probably damaging 1.00
R6234:Hc UTSW 2 35028046 missense probably benign
R6264:Hc UTSW 2 35006273 critical splice acceptor site probably null
R6313:Hc UTSW 2 34989839 splice site probably null
R6525:Hc UTSW 2 34991224 missense probably benign 0.06
R6577:Hc UTSW 2 35032126 missense probably benign 0.00
R6601:Hc UTSW 2 35045894 missense probably benign 0.03
R6916:Hc UTSW 2 35010032 nonsense probably null
R7108:Hc UTSW 2 35039694 missense probably benign 0.03
R7143:Hc UTSW 2 35050438 missense probably benign 0.00
R7388:Hc UTSW 2 34984847 splice site probably null
R7468:Hc UTSW 2 35028051 missense probably benign 0.00
R7504:Hc UTSW 2 35061319 missense not run
R7521:Hc UTSW 2 35045332 missense possibly damaging 0.80
R7582:Hc UTSW 2 34991266 missense possibly damaging 0.70
R7596:Hc UTSW 2 35000847 missense probably damaging 0.96
R7599:Hc UTSW 2 35050419 missense probably damaging 1.00
R7692:Hc UTSW 2 35024149 missense probably damaging 1.00
R7853:Hc UTSW 2 35010033 missense probably damaging 1.00
R7877:Hc UTSW 2 34997399 nonsense probably null
R8375:Hc UTSW 2 34983719 missense probably benign 0.32
X0066:Hc UTSW 2 34983711 missense probably damaging 1.00
Z1088:Hc UTSW 2 35008249 missense possibly damaging 0.94
Z1088:Hc UTSW 2 35029470 missense probably benign 0.02
Z1176:Hc UTSW 2 35006273 critical splice acceptor site probably null
Z1177:Hc UTSW 2 35013610 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGATGACCCGTGCTTTAG -3'
(R):5'- AATGCTCTCTTAGGTCCATCTG -3'

Sequencing Primer
(F):5'- GTGAGCTATAAGACCCTAGTCCTAG -3'
(R):5'- CTGTCTCCAGATGAATATGTGTATTC -3'
Posted On2017-09-21