Incidental Mutation 'R0523:Pde1c'
Institutional Source Beutler Lab
Gene Symbol Pde1c
Ensembl Gene ENSMUSG00000004347
Gene Namephosphodiesterase 1C
MMRRC Submission 038716-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R0523 (G1)
Quality Score225
Status Not validated
Chromosomal Location56069804-56569103 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 56174941 bp
Amino Acid Change Leucine to Phenylalanine at position 252 (L252F)
Ref Sequence ENSEMBL: ENSMUSP00000145508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044505] [ENSMUST00000114327] [ENSMUST00000164037] [ENSMUST00000164752] [ENSMUST00000166102] [ENSMUST00000166890] [ENSMUST00000168944] [ENSMUST00000170774] [ENSMUST00000203372]
Predicted Effect probably damaging
Transcript: ENSMUST00000044505
AA Change: L192F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046601
Gene: ENSMUSG00000004347
AA Change: L192F

Pfam:PDEase_I_N 82 142 3.8e-34 PFAM
HDc 225 390 1.02e-5 SMART
Blast:HDc 402 681 1e-123 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000114327
AA Change: L192F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109966
Gene: ENSMUSG00000004347
AA Change: L192F

Pfam:PDEase_I_N 82 142 4.7e-31 PFAM
HDc 225 390 1.02e-5 SMART
Blast:HDc 402 650 1e-110 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000164037
AA Change: L183F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130139
Gene: ENSMUSG00000004347
AA Change: L183F

Pfam:PDEase_I_N 73 133 8e-32 PFAM
HDc 216 381 1.02e-5 SMART
Blast:HDc 393 618 1e-102 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000164752
AA Change: L192F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129185
Gene: ENSMUSG00000004347
AA Change: L192F

Pfam:PDEase_I_N 82 142 3e-28 PFAM
HDc 225 390 5.7e-8 SMART
Blast:HDc 402 627 1e-101 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000166102
AA Change: L192F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131350
Gene: ENSMUSG00000004347
AA Change: L192F

Pfam:PDEase_I_N 82 142 3e-28 PFAM
HDc 225 390 5.7e-8 SMART
Blast:HDc 402 627 1e-101 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000166890
AA Change: L164F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131892
Gene: ENSMUSG00000004347
AA Change: L164F

Pfam:PDEase_I_N 54 114 3.5e-31 PFAM
HDc 197 362 1.02e-5 SMART
Blast:HDc 374 599 1e-102 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000168944
AA Change: L192F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128364
Gene: ENSMUSG00000004347
AA Change: L192F

Pfam:PDEase_I_N 82 142 4.7e-31 PFAM
HDc 225 390 1.02e-5 SMART
Blast:HDc 402 650 1e-110 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000170774
AA Change: L155F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133170
Gene: ENSMUSG00000004347
AA Change: L155F

Pfam:PDEase_I_N 45 105 3.6e-31 PFAM
HDc 188 353 1.02e-5 SMART
Blast:HDc 365 613 1e-110 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198921
Predicted Effect probably damaging
Transcript: ENSMUST00000203372
AA Change: L252F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145508
Gene: ENSMUSG00000004347
AA Change: L252F

Pfam:PDEase_I_N 142 202 3.1e-31 PFAM
HDc 285 450 5.8e-8 SMART
Blast:HDc 462 741 1e-122 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204821
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that belongs to the 3'5'-cyclic nucleotide phosphodiesterase family. Members of this family catalyze hydrolysis of the cyclic nucleotides, cyclic adenosine monophosphate and cyclic guanosine monophosphate, to the corresponding nucleoside 5'-monophosphates. The enzyme encoded by this gene regulates proliferation and migration of vascular smooth muscle cells, and neointimal hyperplasia. This enzyme also plays a role in pathological vascular remodeling by regulating the stability of growth factor receptors, such as PDGF-receptor-beta. [provided by RefSeq, Jul 2016]
PHENOTYPE: Olfactory sensory nerves from homozygous null mice have significantly reduced action potentials in response to odor with slower onset kinetics and a faster response termination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,644,629 M1K probably null Het
2410089E03Rik T A 15: 8,194,386 Y878N probably damaging Het
A2ml1 T C 6: 128,558,326 D807G possibly damaging Het
Actl9 T A 17: 33,433,349 W128R probably damaging Het
Aggf1 T C 13: 95,356,416 I562V probably damaging Het
Ano3 T A 2: 110,884,855 E79D probably benign Het
Apobec1 T A 6: 122,581,545 I84F probably damaging Het
Atp6v1b2 T C 8: 69,109,985 F458L possibly damaging Het
BC051142 G T 17: 34,445,499 probably null Het
Bco2 A T 9: 50,534,626 V490E probably damaging Het
Catsperg1 G A 7: 29,185,190 probably benign Het
Cdc37 T C 9: 21,142,996 K111R probably damaging Het
Cfap54 T C 10: 92,908,883 probably benign Het
Cpox T A 16: 58,675,245 C308* probably null Het
Ctnna3 T G 10: 64,675,909 M626R probably damaging Het
Cyp2c68 T C 19: 39,739,429 E93G probably benign Het
Cyp2s1 G A 7: 25,806,050 R330W probably damaging Het
Diaph1 C T 18: 37,856,500 V860I possibly damaging Het
Dicer1 A G 12: 104,702,491 S1311P probably damaging Het
Dpyd G A 3: 118,899,203 R332K probably benign Het
E130308A19Rik G A 4: 59,719,716 R416H probably damaging Het
Eef1d T C 15: 75,903,156 D218G probably benign Het
Eif2ak1 T C 5: 143,882,166 V215A probably damaging Het
Eif2ak4 T C 2: 118,442,096 probably null Het
Fam71e2 A G 7: 4,759,393 S246P possibly damaging Het
Fcrl5 T C 3: 87,457,792 S583P possibly damaging Het
Grid2ip C A 5: 143,373,043 Q29K possibly damaging Het
Htr1f A T 16: 64,925,899 N343K probably damaging Het
Hvcn1 T C 5: 122,216,365 probably null Het
Igf2r T C 17: 12,692,064 I1956V probably benign Het
Impdh2 A T 9: 108,561,819 probably null Het
Impdh2 C T 9: 108,561,820 T96I possibly damaging Het
Lactb C G 9: 66,970,692 G285A probably benign Het
Lrrc43 T C 5: 123,501,242 S445P probably damaging Het
Maats1 G A 16: 38,328,374 P231S probably damaging Het
Mapk12 T G 15: 89,135,645 M120L probably benign Het
Mroh8 C G 2: 157,224,036 A669P probably damaging Het
Mrpl38 A C 11: 116,132,018 H373Q probably benign Het
Myocd A G 11: 65,180,902 V740A probably damaging Het
Naprt A G 15: 75,892,465 F300S probably damaging Het
Ncam2 T C 16: 81,461,643 I271T probably damaging Het
Nek4 A G 14: 30,980,038 T582A probably benign Het
Notch2 C T 3: 98,070,970 T89I probably benign Het
Notch2 G A 3: 98,111,598 R692H probably benign Het
Nt5c3 A T 6: 56,883,681 N296K probably damaging Het
Nt5c3b T A 11: 100,436,210 I87F probably damaging Het
Oas3 T C 5: 120,766,144 Q555R unknown Het
Olfr1013 T A 2: 85,769,929 S43T probably benign Het
Olfr494 A T 7: 108,368,231 H247L probably damaging Het
Olfr699 A G 7: 106,790,326 V225A probably damaging Het
P3h1 C A 4: 119,241,530 Q410K probably benign Het
Pax3 A G 1: 78,195,441 V44A possibly damaging Het
Pdzd7 T A 19: 45,036,090 T497S probably benign Het
Piezo2 T C 18: 63,022,481 T253A probably damaging Het
Pipox T C 11: 77,892,139 E79G probably damaging Het
Pole G T 5: 110,303,593 M829I probably damaging Het
Ppp1r12c A T 7: 4,489,772 L156Q probably damaging Het
Psme2b T G 11: 48,945,782 T113P probably damaging Het
Ptprq A G 10: 107,580,220 I1739T possibly damaging Het
Qser1 T C 2: 104,789,676 T174A probably damaging Het
Rcor3 T G 1: 192,130,436 D81A probably damaging Het
Rev3l T C 10: 39,848,049 V785A probably benign Het
Rnf11 T C 4: 109,456,922 D90G probably benign Het
Sh3tc1 GCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCC 5: 35,724,066 probably benign Het
Smad2 T A 18: 76,262,552 S21T probably benign Het
Smc4 A G 3: 69,025,888 D639G probably damaging Het
Smtn A T 11: 3,524,664 S716T possibly damaging Het
Smug1 G T 15: 103,155,709 Q262K probably benign Het
Sspo G T 6: 48,451,860 G403V probably benign Het
Tas2r131 A G 6: 132,957,451 F132L possibly damaging Het
Tgm3 T C 2: 130,044,662 probably null Het
Tigd2 C T 6: 59,210,373 T75M probably benign Het
Tnfrsf13b T C 11: 61,147,587 V232A probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trim47 A G 11: 116,107,890 L301S probably damaging Het
Trim75 G A 8: 64,983,790 H3Y probably benign Het
Trp53bp1 C A 2: 121,251,868 A317S probably null Het
Ttc29 G C 8: 78,276,837 L227F probably benign Het
Ttc39d G A 17: 80,216,457 D182N possibly damaging Het
Ttll10 T A 4: 156,045,361 R164* probably null Het
Ufsp2 T A 8: 45,996,743 D447E probably benign Het
Ugt2b37 T A 5: 87,251,832 L272F possibly damaging Het
Vps13b T C 15: 35,472,050 V833A probably benign Het
Zbbx T C 3: 75,081,858 T308A probably benign Het
Zfp933 G A 4: 147,826,462 Q226* probably null Het
Other mutations in Pde1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Pde1c APN 6 56173674 missense probably damaging 1.00
IGL02316:Pde1c APN 6 56151351 missense possibly damaging 0.77
IGL02751:Pde1c APN 6 56181688 missense probably damaging 1.00
IGL02801:Pde1c APN 6 56173666 missense probably damaging 1.00
IGL02975:Pde1c APN 6 56158936 missense probably damaging 1.00
IGL03357:Pde1c APN 6 56180093 missense probably damaging 1.00
R0717:Pde1c UTSW 6 56123012 missense probably damaging 0.98
R0973:Pde1c UTSW 6 56361815 missense probably benign 0.00
R1344:Pde1c UTSW 6 56361767 missense probably benign 0.08
R1521:Pde1c UTSW 6 56173607 missense possibly damaging 0.91
R1818:Pde1c UTSW 6 56126892 nonsense probably null
R2004:Pde1c UTSW 6 56159011 missense probably damaging 1.00
R2026:Pde1c UTSW 6 56180190 missense probably damaging 1.00
R4380:Pde1c UTSW 6 56072278 missense probably null 0.02
R4729:Pde1c UTSW 6 56072209 missense probably damaging 1.00
R4847:Pde1c UTSW 6 56123034 missense possibly damaging 0.52
R4993:Pde1c UTSW 6 56150624 missense probably damaging 0.98
R5666:Pde1c UTSW 6 56126857 critical splice donor site probably null
R6005:Pde1c UTSW 6 56479202 splice site probably null
R6636:Pde1c UTSW 6 56180102 missense probably damaging 1.00
R6701:Pde1c UTSW 6 56181700 missense probably damaging 1.00
R6990:Pde1c UTSW 6 56442035 missense possibly damaging 0.92
R7607:Pde1c UTSW 6 56150628 missense probably damaging 1.00
R7622:Pde1c UTSW 6 56126925 missense probably damaging 1.00
R8260:Pde1c UTSW 6 56137419 missense probably benign
R8416:Pde1c UTSW 6 56151291 critical splice donor site probably null
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ggtaactgtccattttctcatctg -3'
Posted On2013-06-12