Incidental Mutation 'R6182:Pkd1l1'
ID487048
Institutional Source Beutler Lab
Gene Symbol Pkd1l1
Ensembl Gene ENSMUSG00000046634
Gene Namepolycystic kidney disease 1 like 1
Synonyms
MMRRC Submission 044324-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6182 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location8826708-8973266 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8865555 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1452 (E1452G)
Ref Sequence ENSEMBL: ENSMUSP00000136518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178195]
Predicted Effect unknown
Transcript: ENSMUST00000154153
AA Change: E1902G
SMART Domains Protein: ENSMUSP00000120803
Gene: ENSMUSG00000046634
AA Change: E1902G

DomainStartEndE-ValueType
low complexity region 172 184 N/A INTRINSIC
PKD 205 287 2.9e0 SMART
PKD 291 369 1.42e-9 SMART
Pfam:REJ 398 1001 1.7e-45 PFAM
low complexity region 1208 1218 N/A INTRINSIC
GPS 1370 1413 1.21e-1 SMART
transmembrane domain 1434 1451 N/A INTRINSIC
LH2 1479 1598 2.94e-3 SMART
transmembrane domain 1640 1659 N/A INTRINSIC
transmembrane domain 1679 1701 N/A INTRINSIC
transmembrane domain 1817 1839 N/A INTRINSIC
transmembrane domain 1854 1876 N/A INTRINSIC
Pfam:PKD_channel 2109 2339 1.5e-23 PFAM
transmembrane domain 2381 2403 N/A INTRINSIC
low complexity region 2436 2449 N/A INTRINSIC
low complexity region 2458 2469 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155886
Predicted Effect probably benign
Transcript: ENSMUST00000178195
AA Change: E1452G

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000136518
Gene: ENSMUSG00000046634
AA Change: E1452G

DomainStartEndE-ValueType
Pfam:REJ 3 552 3.3e-41 PFAM
low complexity region 757 767 N/A INTRINSIC
Blast:GPS 919 965 2e-13 BLAST
transmembrane domain 983 1000 N/A INTRINSIC
Pfam:PLAT 1030 1145 7.2e-14 PFAM
transmembrane domain 1189 1208 N/A INTRINSIC
transmembrane domain 1228 1250 N/A INTRINSIC
transmembrane domain 1366 1388 N/A INTRINSIC
transmembrane domain 1403 1425 N/A INTRINSIC
Pfam:PKD_channel 1658 1889 2e-25 PFAM
transmembrane domain 1930 1952 N/A INTRINSIC
low complexity region 1985 1998 N/A INTRINSIC
low complexity region 2007 2018 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family containing 11 transmembrane domains, a receptor for egg jelly (REJ) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. The encoded protein may play a role in the male reproductive system. Alternative splice variants have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU induced point mutation display lethality throughout fetal growth and development with abnormalities in left right patterning and heterotaxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts7 T C 9: 90,192,436 S884P probably benign Het
Akap13 C A 7: 75,586,280 A201E probably benign Het
Ccdc151 A G 9: 21,990,402 F553S probably damaging Het
Ces1f T G 8: 93,256,496 E540A probably benign Het
Chid1 T A 7: 141,528,502 M137L probably benign Het
Chsy3 A G 18: 59,179,342 T296A probably benign Het
Clec4f A G 6: 83,645,302 V519A probably benign Het
Clk4 T A 11: 51,268,182 F41I possibly damaging Het
Cntnap5c A G 17: 57,876,395 D32G probably benign Het
Ctsl T C 13: 64,367,972 Y95C probably damaging Het
Cyp2c54 T C 19: 40,047,561 M302V probably benign Het
Cyp2c65 C G 19: 39,061,162 L45V probably benign Het
Cyp2j6 G C 4: 96,536,086 L145V probably damaging Het
Daam1 C T 12: 71,959,887 Q693* probably null Het
Dgcr8 A T 16: 18,280,308 D406E probably benign Het
Dock2 G T 11: 34,229,476 P1760Q probably damaging Het
Epb41l2 G A 10: 25,507,817 R940H probably damaging Het
Erc2 A C 14: 28,317,253 D951A probably damaging Het
Fbxw7 T C 3: 84,815,771 probably null Het
Frem2 T A 3: 53,647,969 I1716F probably damaging Het
Fus A G 7: 127,977,293 D295G probably damaging Het
Gm5093 A G 17: 46,439,642 I153T probably benign Het
Gnptab T C 10: 88,429,480 V318A possibly damaging Het
Gpc2 T C 5: 138,278,414 D150G probably benign Het
Gsc2 A G 16: 17,913,619 *215R probably null Het
Hectd3 T C 4: 117,000,279 S552P probably damaging Het
Katnal1 C A 5: 148,904,597 K152N possibly damaging Het
Kcnh1 A T 1: 192,191,053 T16S probably damaging Het
Lrrc71 T C 3: 87,745,794 D105G probably benign Het
Mon2 T C 10: 123,038,659 probably null Het
Mpp6 A G 6: 50,198,226 I506V probably benign Het
Mroh9 G A 1: 163,066,043 Q188* probably null Het
Mtmr14 A G 6: 113,269,508 S81G possibly damaging Het
Nrap T A 19: 56,361,698 M628L probably benign Het
Olfr107 T A 17: 37,405,992 I148K possibly damaging Het
Olfr173 A G 16: 58,797,292 Y185H probably damaging Het
Pate4 A T 9: 35,608,290 S35T possibly damaging Het
Pld5 T C 1: 176,044,854 D239G probably benign Het
Ppef2 C T 5: 92,227,066 V728M probably damaging Het
Rasip1 TGCCGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCGC 7: 45,628,455 probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Serpina3c C A 12: 104,149,431 V285L probably benign Het
Serpinb9f T C 13: 33,334,422 S302P probably damaging Het
Sis C T 3: 72,904,293 V1642I probably benign Het
Slc12a4 G A 8: 105,947,899 L601F probably damaging Het
Slc39a6 G T 18: 24,600,956 N225K probably benign Het
Snrnp70 G A 7: 45,377,073 R291* probably null Het
Spin1 C T 13: 51,144,338 T131I probably benign Het
St18 T G 1: 6,844,118 probably null Het
Stox1 A G 10: 62,664,942 L613P probably damaging Het
Tgm3 T G 2: 130,025,301 Y155* probably null Het
Tmem67 T C 4: 12,051,402 I809V probably benign Het
Tnc T A 4: 64,008,796 D831V probably damaging Het
Ttll13 A T 7: 80,260,233 E762D probably benign Het
Unc5b A T 10: 60,765,236 V937E probably damaging Het
Vmn1r34 A G 6: 66,637,328 I142T probably damaging Het
Vmn2r104 A G 17: 20,030,245 M588T probably benign Het
Vmn2r77 T C 7: 86,811,749 V761A probably damaging Het
Wdr48 G T 9: 119,924,766 G665W probably damaging Het
Xpot T A 10: 121,606,258 R550S probably damaging Het
Ydjc A G 16: 17,147,079 T33A probably benign Het
Zfc3h1 A G 10: 115,390,859 T274A probably benign Het
Zfp202 G A 9: 40,207,342 G17E probably damaging Het
Zfp788 T A 7: 41,650,516 C859S probably damaging Het
Zscan4c T C 7: 11,006,782 M76T probably benign Het
Other mutations in Pkd1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Pkd1l1 APN 11 8961971 missense unknown
IGL00156:Pkd1l1 APN 11 8950515 missense probably damaging 1.00
IGL00161:Pkd1l1 APN 11 8929353 critical splice donor site probably null
IGL00489:Pkd1l1 APN 11 8834773 critical splice donor site probably null
IGL00495:Pkd1l1 APN 11 8868493 missense probably benign 0.34
IGL00983:Pkd1l1 APN 11 8844585 missense probably benign
IGL01071:Pkd1l1 APN 11 8848921 missense probably benign 0.00
IGL01093:Pkd1l1 APN 11 8901345 missense probably benign 0.06
IGL01295:Pkd1l1 APN 11 8933685 missense possibly damaging 0.93
IGL01311:Pkd1l1 APN 11 8901174 missense possibly damaging 0.53
IGL01412:Pkd1l1 APN 11 8950409 missense possibly damaging 0.73
IGL01978:Pkd1l1 APN 11 8961336 missense unknown
IGL01999:Pkd1l1 APN 11 8836291 missense probably benign
IGL02080:Pkd1l1 APN 11 8961345 missense unknown
IGL02106:Pkd1l1 APN 11 8833800 missense probably damaging 1.00
IGL02216:Pkd1l1 APN 11 8834897 missense probably damaging 0.96
IGL02305:Pkd1l1 APN 11 8902467 missense probably benign
IGL02337:Pkd1l1 APN 11 8942079 missense probably damaging 1.00
IGL02576:Pkd1l1 APN 11 8844560 missense possibly damaging 0.61
IGL02704:Pkd1l1 APN 11 8834910 missense probably benign 0.00
IGL02814:Pkd1l1 APN 11 8902582 missense probably benign 0.01
IGL02904:Pkd1l1 APN 11 8868450 splice site probably benign
IGL02972:Pkd1l1 APN 11 8863908 missense probably damaging 0.99
IGL03091:Pkd1l1 APN 11 8855564 missense probably damaging 1.00
IGL03113:Pkd1l1 APN 11 8834793 missense probably benign 0.20
IGL03210:Pkd1l1 APN 11 8965127 missense unknown
PIT4581001:Pkd1l1 UTSW 11 8916298 frame shift probably null
R0020:Pkd1l1 UTSW 11 8875765 splice site probably benign
R0020:Pkd1l1 UTSW 11 8875765 splice site probably benign
R0496:Pkd1l1 UTSW 11 8929430 missense probably damaging 0.96
R0547:Pkd1l1 UTSW 11 8836448 splice site probably benign
R0582:Pkd1l1 UTSW 11 8931699 splice site probably benign
R0761:Pkd1l1 UTSW 11 8854375 missense probably damaging 1.00
R0969:Pkd1l1 UTSW 11 8936898 missense probably damaging 1.00
R1348:Pkd1l1 UTSW 11 8834806 missense probably benign 0.18
R1366:Pkd1l1 UTSW 11 8941038 splice site probably benign
R1401:Pkd1l1 UTSW 11 8854487 nonsense probably null
R1444:Pkd1l1 UTSW 11 8854386 missense probably damaging 1.00
R1445:Pkd1l1 UTSW 11 8870313 missense probably benign 0.00
R1463:Pkd1l1 UTSW 11 8916302 missense probably damaging 1.00
R1496:Pkd1l1 UTSW 11 8941077 missense possibly damaging 0.95
R1542:Pkd1l1 UTSW 11 8874179 missense possibly damaging 0.82
R1543:Pkd1l1 UTSW 11 8901200 missense probably damaging 1.00
R1619:Pkd1l1 UTSW 11 8950413 missense probably damaging 0.98
R1875:Pkd1l1 UTSW 11 8844670 splice site probably benign
R1929:Pkd1l1 UTSW 11 8836197 splice site probably benign
R1958:Pkd1l1 UTSW 11 8874161 missense probably benign 0.01
R2223:Pkd1l1 UTSW 11 8889063 missense probably benign 0.18
R2223:Pkd1l1 UTSW 11 8950422 missense probably benign
R2264:Pkd1l1 UTSW 11 8879112 missense probably damaging 0.97
R2349:Pkd1l1 UTSW 11 8826819 splice site probably null
R2431:Pkd1l1 UTSW 11 8947197 missense probably damaging 0.99
R2483:Pkd1l1 UTSW 11 8962701 missense probably damaging 1.00
R2517:Pkd1l1 UTSW 11 8958900 missense unknown
R2888:Pkd1l1 UTSW 11 8947251 missense probably damaging 1.00
R2965:Pkd1l1 UTSW 11 8874236 missense probably damaging 1.00
R3123:Pkd1l1 UTSW 11 8973021 missense unknown
R3153:Pkd1l1 UTSW 11 8867207 missense probably benign 0.01
R3840:Pkd1l1 UTSW 11 8889050 missense probably damaging 1.00
R3855:Pkd1l1 UTSW 11 8965047 critical splice donor site probably null
R3880:Pkd1l1 UTSW 11 8961983 missense unknown
R3970:Pkd1l1 UTSW 11 8874218 missense probably damaging 1.00
R4195:Pkd1l1 UTSW 11 8909929 missense probably damaging 1.00
R4196:Pkd1l1 UTSW 11 8909929 missense probably damaging 1.00
R4246:Pkd1l1 UTSW 11 8865543 missense possibly damaging 0.51
R4247:Pkd1l1 UTSW 11 8865543 missense possibly damaging 0.51
R4249:Pkd1l1 UTSW 11 8865543 missense possibly damaging 0.51
R4250:Pkd1l1 UTSW 11 8865543 missense possibly damaging 0.51
R4593:Pkd1l1 UTSW 11 8901253 missense probably damaging 0.97
R4609:Pkd1l1 UTSW 11 8958964 missense unknown
R4797:Pkd1l1 UTSW 11 8961340 missense unknown
R4910:Pkd1l1 UTSW 11 8929360 missense possibly damaging 0.50
R4940:Pkd1l1 UTSW 11 8844585 missense probably benign
R5084:Pkd1l1 UTSW 11 8942004 missense probably benign 0.05
R5147:Pkd1l1 UTSW 11 8849003 missense possibly damaging 0.71
R5360:Pkd1l1 UTSW 11 8879204 missense probably benign
R5483:Pkd1l1 UTSW 11 8901141 critical splice donor site probably null
R5604:Pkd1l1 UTSW 11 8833877 missense probably damaging 0.98
R5642:Pkd1l1 UTSW 11 8879202 missense probably damaging 1.00
R5652:Pkd1l1 UTSW 11 8909889 missense probably benign 0.03
R5751:Pkd1l1 UTSW 11 8867204 missense possibly damaging 0.45
R5761:Pkd1l1 UTSW 11 8916301 missense probably damaging 1.00
R5800:Pkd1l1 UTSW 11 8861302 missense probably benign
R5874:Pkd1l1 UTSW 11 8908688 missense probably damaging 1.00
R5897:Pkd1l1 UTSW 11 8879176 missense probably benign 0.03
R5913:Pkd1l1 UTSW 11 8863849 missense probably benign 0.00
R5930:Pkd1l1 UTSW 11 8958969 missense unknown
R6000:Pkd1l1 UTSW 11 8950427 missense probably benign 0.00
R6005:Pkd1l1 UTSW 11 8857113 missense probably damaging 1.00
R6013:Pkd1l1 UTSW 11 8869452 splice site probably null
R6027:Pkd1l1 UTSW 11 8916272 nonsense probably null
R6028:Pkd1l1 UTSW 11 8836267 missense probably benign 0.06
R6129:Pkd1l1 UTSW 11 8868543 missense probably benign 0.00
R6226:Pkd1l1 UTSW 11 8901287 missense probably benign 0.00
R6257:Pkd1l1 UTSW 11 8942195 missense probably benign 0.22
R6340:Pkd1l1 UTSW 11 8844649 missense probably benign 0.09
R6478:Pkd1l1 UTSW 11 8863911 missense probably benign 0.00
R6558:Pkd1l1 UTSW 11 8889052 missense probably benign 0.00
R6750:Pkd1l1 UTSW 11 8973217 missense unknown
R6987:Pkd1l1 UTSW 11 8902575 missense probably benign 0.01
R6996:Pkd1l1 UTSW 11 8849046 missense probably damaging 1.00
R7139:Pkd1l1 UTSW 11 8890737 missense
R7224:Pkd1l1 UTSW 11 8945241 missense
R7244:Pkd1l1 UTSW 11 8871771 missense
R7265:Pkd1l1 UTSW 11 8929402 missense
R7358:Pkd1l1 UTSW 11 8945202 missense
R7387:Pkd1l1 UTSW 11 8901203 missense
R7414:Pkd1l1 UTSW 11 8916267 missense
R7459:Pkd1l1 UTSW 11 8902428 missense
R7478:Pkd1l1 UTSW 11 8929441 missense
R7485:Pkd1l1 UTSW 11 8965148 missense
R7490:Pkd1l1 UTSW 11 8916265 missense
R7644:Pkd1l1 UTSW 11 8875758 missense
R7647:Pkd1l1 UTSW 11 8947296 missense
R7676:Pkd1l1 UTSW 11 8962708 missense
R7687:Pkd1l1 UTSW 11 8854390 missense
R8052:Pkd1l1 UTSW 11 8947315 missense
X0024:Pkd1l1 UTSW 11 8950413 missense probably benign 0.01
X0063:Pkd1l1 UTSW 11 8929430 missense probably damaging 0.96
X0065:Pkd1l1 UTSW 11 8909921 missense probably benign 0.10
Z1176:Pkd1l1 UTSW 11 8826801 missense
Z1177:Pkd1l1 UTSW 11 8945208 missense
Predicted Primers PCR Primer
(F):5'- TCACTGGGATTGGGGTAAATGTAAG -3'
(R):5'- ACCAGAAAGATGGCTCTGTGG -3'

Sequencing Primer
(F):5'- GGAAAGAAGCTTAAGAAATTCACAC -3'
(R):5'- TCTGTGGGAGGGGCACAAAC -3'
Posted On2017-10-10