Incidental Mutation 'R6182:Ctsl'
ID487055
Institutional Source Beutler Lab
Gene Symbol Ctsl
Ensembl Gene ENSMUSG00000021477
Gene Namecathepsin L
Synonymsmajor excreted protein, 1190035F06Rik, Cat L, MEP
MMRRC Submission 044324-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6182 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location64359337-64370890 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64367972 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 95 (Y95C)
Ref Sequence ENSEMBL: ENSMUSP00000152497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021933] [ENSMUST00000220737] [ENSMUST00000222462] [ENSMUST00000222517] [ENSMUST00000223494]
Predicted Effect probably damaging
Transcript: ENSMUST00000021933
AA Change: Y95C

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000021933
Gene: ENSMUSG00000021477
AA Change: Y95C

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Inhibitor_I29 29 88 1.98e-23 SMART
Pept_C1 114 332 1.67e-128 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220617
Predicted Effect possibly damaging
Transcript: ENSMUST00000220737
AA Change: Y95C

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221233
Predicted Effect probably damaging
Transcript: ENSMUST00000222462
AA Change: Y95C

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000222517
AA Change: Y95C

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000222971
Predicted Effect probably benign
Transcript: ENSMUST00000223494
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase C1 (papain) family of cysteine proteases. The encoded preproprotein is proteolytically processed to generate multiple protein products. These products include the activation peptide and the cathepsin L1 heavy and light chains. The mature enzyme appears to be important in embryonic development through its processing of histone H3 and may play a role in disease progression in a model of kidney disease. Homozygous knockout mice for this gene exhibit hair loss, skin thickening, bone and heart defects, and enhanced susceptibility to bacterial infection. A pseudogene of this gene has been identified in the genome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for mutant alleles may show partial or complete hair-loss, skin defects, impaired T cell maturation, dilated cardiomyopathy, and high postnatal mortality. Mutant males for some alleles show both normal and atrophic seminiferous tubules and reduced sperm production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts7 T C 9: 90,192,436 S884P probably benign Het
Akap13 C A 7: 75,586,280 A201E probably benign Het
Ccdc151 A G 9: 21,990,402 F553S probably damaging Het
Ces1f T G 8: 93,256,496 E540A probably benign Het
Chid1 T A 7: 141,528,502 M137L probably benign Het
Chsy3 A G 18: 59,179,342 T296A probably benign Het
Clec4f A G 6: 83,645,302 V519A probably benign Het
Clk4 T A 11: 51,268,182 F41I possibly damaging Het
Cntnap5c A G 17: 57,876,395 D32G probably benign Het
Cyp2c54 T C 19: 40,047,561 M302V probably benign Het
Cyp2c65 C G 19: 39,061,162 L45V probably benign Het
Cyp2j6 G C 4: 96,536,086 L145V probably damaging Het
Daam1 C T 12: 71,959,887 Q693* probably null Het
Dgcr8 A T 16: 18,280,308 D406E probably benign Het
Dock2 G T 11: 34,229,476 P1760Q probably damaging Het
Epb41l2 G A 10: 25,507,817 R940H probably damaging Het
Erc2 A C 14: 28,317,253 D951A probably damaging Het
Fbxw7 T C 3: 84,815,771 probably null Het
Frem2 T A 3: 53,647,969 I1716F probably damaging Het
Fus A G 7: 127,977,293 D295G probably damaging Het
Gm5093 A G 17: 46,439,642 I153T probably benign Het
Gnptab T C 10: 88,429,480 V318A possibly damaging Het
Gpc2 T C 5: 138,278,414 D150G probably benign Het
Gsc2 A G 16: 17,913,619 *215R probably null Het
Hectd3 T C 4: 117,000,279 S552P probably damaging Het
Katnal1 C A 5: 148,904,597 K152N possibly damaging Het
Kcnh1 A T 1: 192,191,053 T16S probably damaging Het
Lrrc71 T C 3: 87,745,794 D105G probably benign Het
Mon2 T C 10: 123,038,659 probably null Het
Mpp6 A G 6: 50,198,226 I506V probably benign Het
Mroh9 G A 1: 163,066,043 Q188* probably null Het
Mtmr14 A G 6: 113,269,508 S81G possibly damaging Het
Nrap T A 19: 56,361,698 M628L probably benign Het
Olfr107 T A 17: 37,405,992 I148K possibly damaging Het
Olfr173 A G 16: 58,797,292 Y185H probably damaging Het
Pate4 A T 9: 35,608,290 S35T possibly damaging Het
Pkd1l1 T C 11: 8,865,555 E1452G probably benign Het
Pld5 T C 1: 176,044,854 D239G probably benign Het
Ppef2 C T 5: 92,227,066 V728M probably damaging Het
Rasip1 TGCCGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCGC 7: 45,628,455 probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Serpina3c C A 12: 104,149,431 V285L probably benign Het
Serpinb9f T C 13: 33,334,422 S302P probably damaging Het
Sis C T 3: 72,904,293 V1642I probably benign Het
Slc12a4 G A 8: 105,947,899 L601F probably damaging Het
Slc39a6 G T 18: 24,600,956 N225K probably benign Het
Snrnp70 G A 7: 45,377,073 R291* probably null Het
Spin1 C T 13: 51,144,338 T131I probably benign Het
St18 T G 1: 6,844,118 probably null Het
Stox1 A G 10: 62,664,942 L613P probably damaging Het
Tgm3 T G 2: 130,025,301 Y155* probably null Het
Tmem67 T C 4: 12,051,402 I809V probably benign Het
Tnc T A 4: 64,008,796 D831V probably damaging Het
Ttll13 A T 7: 80,260,233 E762D probably benign Het
Unc5b A T 10: 60,765,236 V937E probably damaging Het
Vmn1r34 A G 6: 66,637,328 I142T probably damaging Het
Vmn2r104 A G 17: 20,030,245 M588T probably benign Het
Vmn2r77 T C 7: 86,811,749 V761A probably damaging Het
Wdr48 G T 9: 119,924,766 G665W probably damaging Het
Xpot T A 10: 121,606,258 R550S probably damaging Het
Ydjc A G 16: 17,147,079 T33A probably benign Het
Zfc3h1 A G 10: 115,390,859 T274A probably benign Het
Zfp202 G A 9: 40,207,342 G17E probably damaging Het
Zfp788 T A 7: 41,650,516 C859S probably damaging Het
Zscan4c T C 7: 11,006,782 M76T probably benign Het
Other mutations in Ctsl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Ctsl APN 13 64368168 missense probably damaging 1.00
IGL02895:Ctsl APN 13 64366512 missense probably damaging 0.97
mauvais UTSW 13 64364102 unclassified probably null
patch UTSW 13 64366623 nonsense probably null
R0518:Ctsl UTSW 13 64365218 missense possibly damaging 0.75
R0521:Ctsl UTSW 13 64365218 missense possibly damaging 0.75
R1546:Ctsl UTSW 13 64367879 missense probably damaging 1.00
R2096:Ctsl UTSW 13 64369026 critical splice donor site probably null
R5690:Ctsl UTSW 13 64365208 missense probably damaging 1.00
R5804:Ctsl UTSW 13 64366488 missense probably damaging 1.00
R6670:Ctsl UTSW 13 64364102 unclassified probably null
R6725:Ctsl UTSW 13 64366623 nonsense probably null
R6886:Ctsl UTSW 13 64365147 utr 3 prime probably null
R7502:Ctsl UTSW 13 64367068 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCGAGTCTCTTCCAAGTGTG -3'
(R):5'- GAATGATCCAGCTACACAACGGG -3'

Sequencing Primer
(F):5'- TGGACCCTGGGGATCAAACTC -3'
(R):5'- CTTGAACTCTTGAGCCCT -3'
Posted On2017-10-10