Incidental Mutation 'R6182:Olfr173'
ID487060
Institutional Source Beutler Lab
Gene Symbol Olfr173
Ensembl Gene ENSMUSG00000049362
Gene Nameolfactory receptor 173
SynonymsMOR184-3, GA_x54KRFPKG5P-54960233-54959268
MMRRC Submission 044324-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R6182 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location58795207-58800268 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58797292 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 185 (Y185H)
Ref Sequence ENSEMBL: ENSMUSP00000145946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049940] [ENSMUST00000206205]
Predicted Effect probably damaging
Transcript: ENSMUST00000049940
AA Change: Y185H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000052798
Gene: ENSMUSG00000049362
AA Change: Y185H

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.7e-52 PFAM
Pfam:7tm_1 41 290 9.7e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000206205
AA Change: Y185H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts7 T C 9: 90,192,436 S884P probably benign Het
Akap13 C A 7: 75,586,280 A201E probably benign Het
Ccdc151 A G 9: 21,990,402 F553S probably damaging Het
Ces1f T G 8: 93,256,496 E540A probably benign Het
Chid1 T A 7: 141,528,502 M137L probably benign Het
Chsy3 A G 18: 59,179,342 T296A probably benign Het
Clec4f A G 6: 83,645,302 V519A probably benign Het
Clk4 T A 11: 51,268,182 F41I possibly damaging Het
Cntnap5c A G 17: 57,876,395 D32G probably benign Het
Ctsl T C 13: 64,367,972 Y95C probably damaging Het
Cyp2c54 T C 19: 40,047,561 M302V probably benign Het
Cyp2c65 C G 19: 39,061,162 L45V probably benign Het
Cyp2j6 G C 4: 96,536,086 L145V probably damaging Het
Daam1 C T 12: 71,959,887 Q693* probably null Het
Dgcr8 A T 16: 18,280,308 D406E probably benign Het
Dock2 G T 11: 34,229,476 P1760Q probably damaging Het
Epb41l2 G A 10: 25,507,817 R940H probably damaging Het
Erc2 A C 14: 28,317,253 D951A probably damaging Het
Fbxw7 T C 3: 84,815,771 probably null Het
Frem2 T A 3: 53,647,969 I1716F probably damaging Het
Fus A G 7: 127,977,293 D295G probably damaging Het
Gm5093 A G 17: 46,439,642 I153T probably benign Het
Gnptab T C 10: 88,429,480 V318A possibly damaging Het
Gpc2 T C 5: 138,278,414 D150G probably benign Het
Gsc2 A G 16: 17,913,619 *215R probably null Het
Hectd3 T C 4: 117,000,279 S552P probably damaging Het
Katnal1 C A 5: 148,904,597 K152N possibly damaging Het
Kcnh1 A T 1: 192,191,053 T16S probably damaging Het
Lrrc71 T C 3: 87,745,794 D105G probably benign Het
Mon2 T C 10: 123,038,659 probably null Het
Mpp6 A G 6: 50,198,226 I506V probably benign Het
Mroh9 G A 1: 163,066,043 Q188* probably null Het
Mtmr14 A G 6: 113,269,508 S81G possibly damaging Het
Nrap T A 19: 56,361,698 M628L probably benign Het
Olfr107 T A 17: 37,405,992 I148K possibly damaging Het
Pate4 A T 9: 35,608,290 S35T possibly damaging Het
Pkd1l1 T C 11: 8,865,555 E1452G probably benign Het
Pld5 T C 1: 176,044,854 D239G probably benign Het
Ppef2 C T 5: 92,227,066 V728M probably damaging Het
Rasip1 TGCCGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCGC 7: 45,628,455 probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Serpina3c C A 12: 104,149,431 V285L probably benign Het
Serpinb9f T C 13: 33,334,422 S302P probably damaging Het
Sis C T 3: 72,904,293 V1642I probably benign Het
Slc12a4 G A 8: 105,947,899 L601F probably damaging Het
Slc39a6 G T 18: 24,600,956 N225K probably benign Het
Snrnp70 G A 7: 45,377,073 R291* probably null Het
Spin1 C T 13: 51,144,338 T131I probably benign Het
St18 T G 1: 6,844,118 probably null Het
Stox1 A G 10: 62,664,942 L613P probably damaging Het
Tgm3 T G 2: 130,025,301 Y155* probably null Het
Tmem67 T C 4: 12,051,402 I809V probably benign Het
Tnc T A 4: 64,008,796 D831V probably damaging Het
Ttll13 A T 7: 80,260,233 E762D probably benign Het
Unc5b A T 10: 60,765,236 V937E probably damaging Het
Vmn1r34 A G 6: 66,637,328 I142T probably damaging Het
Vmn2r104 A G 17: 20,030,245 M588T probably benign Het
Vmn2r77 T C 7: 86,811,749 V761A probably damaging Het
Wdr48 G T 9: 119,924,766 G665W probably damaging Het
Xpot T A 10: 121,606,258 R550S probably damaging Het
Ydjc A G 16: 17,147,079 T33A probably benign Het
Zfc3h1 A G 10: 115,390,859 T274A probably benign Het
Zfp202 G A 9: 40,207,342 G17E probably damaging Het
Zfp788 T A 7: 41,650,516 C859S probably damaging Het
Zscan4c T C 7: 11,006,782 M76T probably benign Het
Other mutations in Olfr173
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02649:Olfr173 APN 16 58797350 missense probably damaging 1.00
IGL02728:Olfr173 APN 16 58797480 missense probably benign 0.07
IGL02893:Olfr173 APN 16 58797657 missense probably damaging 1.00
R0035:Olfr173 UTSW 16 58797122 nonsense probably null
R0480:Olfr173 UTSW 16 58797321 missense probably benign 0.05
R1101:Olfr173 UTSW 16 58797252 missense probably benign 0.27
R1434:Olfr173 UTSW 16 58797448 missense probably benign 0.06
R1992:Olfr173 UTSW 16 58796946 missense probably benign
R2220:Olfr173 UTSW 16 58797624 missense possibly damaging 0.69
R2436:Olfr173 UTSW 16 58797244 missense probably benign 0.00
R4212:Olfr173 UTSW 16 58797369 missense possibly damaging 0.67
R4910:Olfr173 UTSW 16 58797442 missense probably benign 0.03
R5666:Olfr173 UTSW 16 58797061 missense possibly damaging 0.75
R5670:Olfr173 UTSW 16 58797061 missense possibly damaging 0.75
R5896:Olfr173 UTSW 16 58797732 missense probably damaging 1.00
R6613:Olfr173 UTSW 16 58797531 missense probably damaging 0.99
R6723:Olfr173 UTSW 16 58797432 missense probably benign 0.06
R7051:Olfr173 UTSW 16 58797175 missense probably benign 0.21
R7141:Olfr173 UTSW 16 58797408 missense probably benign 0.05
R7179:Olfr173 UTSW 16 58796887 missense probably benign 0.00
R7602:Olfr173 UTSW 16 58796980 missense possibly damaging 0.62
Z1176:Olfr173 UTSW 16 58797423 missense probably damaging 1.00
Z1176:Olfr173 UTSW 16 58797673 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACAGGTGGAGAAGGCTTTG -3'
(R):5'- AACTGCAGACTGCTTTCTTCTG -3'

Sequencing Primer
(F):5'- AAGGCTTTGATCCTTCCCTC -3'
(R):5'- TGTCAGCAATGGCCTATGAC -3'
Posted On2017-10-10