Incidental Mutation 'R6182:Slc39a6'
ID487065
Institutional Source Beutler Lab
Gene Symbol Slc39a6
Ensembl Gene ENSMUSG00000024270
Gene Namesolute carrier family 39 (metal ion transporter), member 6
SynonymsErmelin
MMRRC Submission 044324-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.314) question?
Stock #R6182 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location24579881-24603817 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 24600956 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 225 (N225K)
Ref Sequence ENSEMBL: ENSMUSP00000064667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025120] [ENSMUST00000070726] [ENSMUST00000152504] [ENSMUST00000154205]
Predicted Effect probably benign
Transcript: ENSMUST00000025120
SMART Domains Protein: ENSMUSP00000025120
Gene: ENSMUSG00000024271

DomainStartEndE-ValueType
WD40 47 91 1.06e-3 SMART
WD40 94 143 2.24e-2 SMART
WD40 196 237 4.69e-5 SMART
WD40 271 319 2.44e-3 SMART
Blast:WD40 329 368 1e-20 BLAST
WD40 376 415 2.12e-3 SMART
WD40 429 467 1.71e1 SMART
WD40 556 600 7.43e-1 SMART
WD40 603 642 1.93e-6 SMART
WD40 661 697 1.55e-5 SMART
Blast:WD40 709 753 7e-21 BLAST
WD40 766 825 1.92e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000070726
AA Change: N225K

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000064667
Gene: ENSMUSG00000024270
AA Change: N225K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 94 141 N/A INTRINSIC
low complexity region 187 198 N/A INTRINSIC
Pfam:Zip 332 753 3e-104 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128106
Predicted Effect probably benign
Transcript: ENSMUST00000152504
Predicted Effect probably benign
Transcript: ENSMUST00000154205
SMART Domains Protein: ENSMUSP00000122151
Gene: ENSMUSG00000024270

DomainStartEndE-ValueType
Pfam:Zip 48 433 2e-94 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc is an essential cofactor for hundreds of enzymes. It is involved in protein, nucleic acid, carbohydrate, and lipid metabolism, as well as in the control of gene transcription, growth, development, and differentiation. SLC39A6 belongs to a subfamily of proteins that show structural characteristics of zinc transporters (Taylor and Nicholson, 2003 [PubMed 12659941]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele do not display any gross skin abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts7 T C 9: 90,192,436 S884P probably benign Het
Akap13 C A 7: 75,586,280 A201E probably benign Het
Ccdc151 A G 9: 21,990,402 F553S probably damaging Het
Ces1f T G 8: 93,256,496 E540A probably benign Het
Chid1 T A 7: 141,528,502 M137L probably benign Het
Chsy3 A G 18: 59,179,342 T296A probably benign Het
Clec4f A G 6: 83,645,302 V519A probably benign Het
Clk4 T A 11: 51,268,182 F41I possibly damaging Het
Cntnap5c A G 17: 57,876,395 D32G probably benign Het
Ctsl T C 13: 64,367,972 Y95C probably damaging Het
Cyp2c54 T C 19: 40,047,561 M302V probably benign Het
Cyp2c65 C G 19: 39,061,162 L45V probably benign Het
Cyp2j6 G C 4: 96,536,086 L145V probably damaging Het
Daam1 C T 12: 71,959,887 Q693* probably null Het
Dgcr8 A T 16: 18,280,308 D406E probably benign Het
Dock2 G T 11: 34,229,476 P1760Q probably damaging Het
Epb41l2 G A 10: 25,507,817 R940H probably damaging Het
Erc2 A C 14: 28,317,253 D951A probably damaging Het
Fbxw7 T C 3: 84,815,771 probably null Het
Frem2 T A 3: 53,647,969 I1716F probably damaging Het
Fus A G 7: 127,977,293 D295G probably damaging Het
Gm5093 A G 17: 46,439,642 I153T probably benign Het
Gnptab T C 10: 88,429,480 V318A possibly damaging Het
Gpc2 T C 5: 138,278,414 D150G probably benign Het
Gsc2 A G 16: 17,913,619 *215R probably null Het
Hectd3 T C 4: 117,000,279 S552P probably damaging Het
Katnal1 C A 5: 148,904,597 K152N possibly damaging Het
Kcnh1 A T 1: 192,191,053 T16S probably damaging Het
Lrrc71 T C 3: 87,745,794 D105G probably benign Het
Mon2 T C 10: 123,038,659 probably null Het
Mpp6 A G 6: 50,198,226 I506V probably benign Het
Mroh9 G A 1: 163,066,043 Q188* probably null Het
Mtmr14 A G 6: 113,269,508 S81G possibly damaging Het
Nrap T A 19: 56,361,698 M628L probably benign Het
Olfr107 T A 17: 37,405,992 I148K possibly damaging Het
Olfr173 A G 16: 58,797,292 Y185H probably damaging Het
Pate4 A T 9: 35,608,290 S35T possibly damaging Het
Pkd1l1 T C 11: 8,865,555 E1452G probably benign Het
Pld5 T C 1: 176,044,854 D239G probably benign Het
Ppef2 C T 5: 92,227,066 V728M probably damaging Het
Rasip1 TGCCGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCGC 7: 45,628,455 probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Serpina3c C A 12: 104,149,431 V285L probably benign Het
Serpinb9f T C 13: 33,334,422 S302P probably damaging Het
Sis C T 3: 72,904,293 V1642I probably benign Het
Slc12a4 G A 8: 105,947,899 L601F probably damaging Het
Snrnp70 G A 7: 45,377,073 R291* probably null Het
Spin1 C T 13: 51,144,338 T131I probably benign Het
St18 T G 1: 6,844,118 probably null Het
Stox1 A G 10: 62,664,942 L613P probably damaging Het
Tgm3 T G 2: 130,025,301 Y155* probably null Het
Tmem67 T C 4: 12,051,402 I809V probably benign Het
Tnc T A 4: 64,008,796 D831V probably damaging Het
Ttll13 A T 7: 80,260,233 E762D probably benign Het
Unc5b A T 10: 60,765,236 V937E probably damaging Het
Vmn1r34 A G 6: 66,637,328 I142T probably damaging Het
Vmn2r104 A G 17: 20,030,245 M588T probably benign Het
Vmn2r77 T C 7: 86,811,749 V761A probably damaging Het
Wdr48 G T 9: 119,924,766 G665W probably damaging Het
Xpot T A 10: 121,606,258 R550S probably damaging Het
Ydjc A G 16: 17,147,079 T33A probably benign Het
Zfc3h1 A G 10: 115,390,859 T274A probably benign Het
Zfp202 G A 9: 40,207,342 G17E probably damaging Het
Zfp788 T A 7: 41,650,516 C859S probably damaging Het
Zscan4c T C 7: 11,006,782 M76T probably benign Het
Other mutations in Slc39a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Slc39a6 APN 18 24589745 critical splice donor site probably null
IGL01412:Slc39a6 APN 18 24585356 missense probably damaging 1.00
IGL02182:Slc39a6 APN 18 24601290 missense probably damaging 0.99
IGL02332:Slc39a6 APN 18 24589823 missense probably benign 0.22
IGL02648:Slc39a6 APN 18 24582367 missense probably damaging 1.00
R0066:Slc39a6 UTSW 18 24599269 missense probably damaging 1.00
R0066:Slc39a6 UTSW 18 24599269 missense probably damaging 1.00
R0729:Slc39a6 UTSW 18 24601470 missense probably benign 0.00
R1128:Slc39a6 UTSW 18 24585292 missense probably damaging 1.00
R1621:Slc39a6 UTSW 18 24600889 missense probably benign 0.08
R1799:Slc39a6 UTSW 18 24585467 missense probably benign 0.00
R1800:Slc39a6 UTSW 18 24585202 missense probably damaging 1.00
R1885:Slc39a6 UTSW 18 24601482 unclassified probably null
R4159:Slc39a6 UTSW 18 24597828 missense possibly damaging 0.88
R4809:Slc39a6 UTSW 18 24585474 nonsense probably null
R4903:Slc39a6 UTSW 18 24597868 missense probably damaging 1.00
R4994:Slc39a6 UTSW 18 24596294 missense probably damaging 1.00
R5352:Slc39a6 UTSW 18 24601036 missense probably benign 0.00
R5398:Slc39a6 UTSW 18 24597879 missense probably damaging 1.00
R5832:Slc39a6 UTSW 18 24601612 missense possibly damaging 0.81
R6853:Slc39a6 UTSW 18 24599319 missense possibly damaging 0.71
R7226:Slc39a6 UTSW 18 24584027 missense probably damaging 1.00
R7252:Slc39a6 UTSW 18 24601385 missense possibly damaging 0.64
R7263:Slc39a6 UTSW 18 24601203 missense probably benign
R7328:Slc39a6 UTSW 18 24600930 missense probably benign 0.00
R7388:Slc39a6 UTSW 18 24584049 missense probably damaging 1.00
R7395:Slc39a6 UTSW 18 24585275 missense probably damaging 1.00
X0065:Slc39a6 UTSW 18 24585375 missense possibly damaging 0.95
Z1176:Slc39a6 UTSW 18 24585315 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGCATTAAATACGGCACAG -3'
(R):5'- AAGCCTTTTGTCCAGACCTTGAC -3'

Sequencing Primer
(F):5'- ACGGCACAGAATTTATCTTACCTC -3'
(R):5'- GTCCAGACCTTGACTCTGATAATTC -3'
Posted On2017-10-10