Incidental Mutation 'R6130:Lepr'
ID487078
Institutional Source Beutler Lab
Gene Symbol Lepr
Ensembl Gene ENSMUSG00000057722
Gene Nameleptin receptor
Synonymsobl, Leprb, Obr, obese-like, OB-RGRP, Modb1, leptin receptor gene-related protein, LEPROT
MMRRC Submission 044277-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6130 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location101717404-101815352 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 101765372 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 450 (S450C)
Ref Sequence ENSEMBL: ENSMUSP00000102534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037552] [ENSMUST00000102777] [ENSMUST00000106921]
Predicted Effect probably damaging
Transcript: ENSMUST00000037552
AA Change: S450C

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000037385
Gene: ENSMUSG00000057722
AA Change: S450C

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
FN3 236 315 1.5e-5 SMART
Pfam:Lep_receptor_Ig 328 418 6.3e-23 PFAM
FN3 535 618 4.93e-1 SMART
FN3 641 721 3.25e1 SMART
FN3 736 818 2.35e0 SMART
transmembrane domain 838 860 N/A INTRINSIC
low complexity region 908 921 N/A INTRINSIC
low complexity region 1050 1065 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102777
AA Change: S450C

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099838
Gene: ENSMUSG00000057722
AA Change: S450C

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
FN3 236 315 1.5e-5 SMART
Pfam:Lep_receptor_Ig 329 420 2.6e-29 PFAM
FN3 535 618 4.93e-1 SMART
FN3 641 721 3.25e1 SMART
FN3 736 818 2.35e0 SMART
transmembrane domain 838 860 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106921
AA Change: S450C

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102534
Gene: ENSMUSG00000057722
AA Change: S450C

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
FN3 236 315 1.5e-5 SMART
Pfam:Lep_receptor_Ig 329 420 2.6e-29 PFAM
FN3 535 618 4.93e-1 SMART
FN3 641 721 3.25e1 SMART
FN3 736 818 2.35e0 SMART
transmembrane domain 838 860 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128948
Meta Mutation Damage Score 0.2850 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the gp130 family of cytokine receptors that are known to stimulate gene transcription via activation of cytosolic STAT proteins. This protein is a receptor for leptin (an adipocyte-specific hormone that regulates body weight), and is involved in the regulation of fat metabolism, as well as in a novel hematopoietic pathway that is required for normal lymphopoiesis. Mutations in this gene have been associated with obesity and pituitary dysfunction. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. It is noteworthy that this gene and LEPROT gene (GeneID:54741) share the same promoter and the first 2 exons, however, encode distinct proteins (PMID:9207021).[provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous mutants are hyperphagic, low-activity, poorly cold-adapted, sterile and have enhanced fat conversion. They are obese, hyperinsulinemic and, on certain strains, severely hyperglycemic. Heterozygotes are normal but resistant to prolonged fasting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abi3 T A 11: 95,837,095 E90V probably damaging Het
Adgrv1 A C 13: 81,427,745 V4834G probably damaging Het
Aen A T 7: 78,902,639 probably null Het
Ankrd55 A G 13: 112,318,446 D26G probably damaging Het
Antxr2 T C 5: 98,004,272 E160G possibly damaging Het
Auts2 T C 5: 131,440,223 H528R probably damaging Het
Casd1 A G 6: 4,641,948 T742A probably damaging Het
Ccdc39 T C 3: 33,841,192 probably null Het
Ctla4 T C 1: 60,912,491 Y60H probably damaging Het
Dennd4b T C 3: 90,276,259 L935P probably damaging Het
Dnah6 T A 6: 73,188,494 T543S probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Fdxacb1 C T 9: 50,772,602 R420* probably null Het
Flg A G 3: 93,292,716 probably benign Het
Fpr1 T A 17: 17,877,635 I31F probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gsta1 T A 9: 78,242,565 F220Y probably damaging Het
Hmg20a T A 9: 56,488,607 probably null Het
Igf2bp1 A C 11: 95,974,020 L201R probably damaging Het
Jph3 G A 8: 121,753,087 R168H probably damaging Het
Kif1a T A 1: 93,036,901 I1318F probably damaging Het
Lamc2 T C 1: 153,136,777 N717S probably benign Het
Muc16 A G 9: 18,590,698 V6535A probably damaging Het
Myom3 A G 4: 135,762,571 T18A probably benign Het
Nlrp5 A G 7: 23,404,173 K22E probably benign Het
Obscn A C 11: 59,077,945 S2534A possibly damaging Het
Olfr318 A G 11: 58,720,307 V247A probably damaging Het
Olfr50 A T 2: 36,794,043 D269V probably benign Het
Pcdhga8 T A 18: 37,727,527 N545K possibly damaging Het
Pcsk5 A T 19: 17,511,556 Y967N probably damaging Het
Ppp1r32 G A 19: 10,477,764 P233L probably benign Het
Robo2 C T 16: 73,920,682 G100S probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Scap A G 9: 110,380,379 T707A possibly damaging Het
Scarf1 A G 11: 75,525,739 Q669R probably benign Het
Scin T C 12: 40,069,436 D531G probably benign Het
Sh2b3 T C 5: 121,815,563 probably null Het
Slco1a6 T C 6: 142,086,429 S657G probably benign Het
Stil T A 4: 115,029,861 probably null Het
Syna T A 5: 134,558,268 Q609L possibly damaging Het
Tmem59l A G 8: 70,484,605 S271P probably damaging Het
Tns2 A G 15: 102,111,241 E522G probably damaging Het
Trappc6a G A 7: 19,515,294 A149T probably benign Het
Trim21 A T 7: 102,563,291 L156H possibly damaging Het
Trpv3 A G 11: 73,296,483 R714G possibly damaging Het
Wdr63 A C 3: 146,042,804 Y852D probably benign Het
Zfp72 T A 13: 74,372,341 Q206L possibly damaging Het
Other mutations in Lepr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Lepr APN 4 101815035 missense probably benign
IGL01111:Lepr APN 4 101814655 missense possibly damaging 0.77
IGL01324:Lepr APN 4 101768068 missense probably benign 0.23
IGL01372:Lepr APN 4 101735577 missense possibly damaging 0.67
IGL01626:Lepr APN 4 101733534 missense probably benign 0.10
IGL01733:Lepr APN 4 101765082 missense probably benign 0.00
IGL01815:Lepr APN 4 101814790 missense possibly damaging 0.49
IGL01899:Lepr APN 4 101779987 missense possibly damaging 0.86
IGL02138:Lepr APN 4 101768067 missense probably damaging 0.98
IGL02161:Lepr APN 4 101745678 missense probably damaging 0.97
IGL02653:Lepr APN 4 101764944 missense probably benign 0.44
IGL02735:Lepr APN 4 101782638 missense probably damaging 1.00
IGL03035:Lepr APN 4 101764980 missense probably damaging 1.00
IGL03083:Lepr APN 4 101814679 nonsense probably null
IGL03160:Lepr APN 4 101764906 missense probably damaging 1.00
business_class UTSW 4 101764872 missense probably damaging 1.00
cherub UTSW 4 101768063 missense probably benign 0.25
clodhopper UTSW 4 101765290 splice site probably null
donner UTSW 4 101815201 missense probably damaging 1.00
fluffy UTSW 4 101792023 missense probably damaging 1.00
giant UTSW 4 101765152 critical splice donor site probably null
gordo UTSW 4 101765305 missense probably damaging 0.97
Immunoglutton UTSW 4 101765301 splice site probably benign
Jumbo_shrimp UTSW 4 101764954 nonsense probably null
odd UTSW 4 101728075 splice site probably benign
paleo UTSW 4 101745645 missense possibly damaging 0.94
well-upholstered UTSW 4 101772959 synonymous probably benign
worldly UTSW 4 101768228 missense possibly damaging 0.96
PIT4651001:Lepr UTSW 4 101791997 missense probably damaging 1.00
PIT4696001:Lepr UTSW 4 101779983 missense probably benign 0.10
R0140:Lepr UTSW 4 101768067 missense probably damaging 1.00
R0197:Lepr UTSW 4 101752152 missense possibly damaging 0.64
R0279:Lepr UTSW 4 101750344 missense probably benign 0.05
R0487:Lepr UTSW 4 101768093 nonsense probably null
R0498:Lepr UTSW 4 101745692 missense probably benign 0.01
R0506:Lepr UTSW 4 101773010 splice site probably benign
R0512:Lepr UTSW 4 101792019 missense probably damaging 1.00
R0512:Lepr UTSW 4 101814704 missense possibly damaging 0.87
R0726:Lepr UTSW 4 101764934 missense probably benign 0.01
R1054:Lepr UTSW 4 101782596 missense probably damaging 0.97
R1109:Lepr UTSW 4 101771355 missense probably damaging 1.00
R1398:Lepr UTSW 4 101792019 missense probably damaging 1.00
R1464:Lepr UTSW 4 101735681 missense probably benign 0.08
R1464:Lepr UTSW 4 101735681 missense probably benign 0.08
R1519:Lepr UTSW 4 101789344 missense probably damaging 0.97
R1602:Lepr UTSW 4 101745645 missense possibly damaging 0.94
R1830:Lepr UTSW 4 101735677 missense probably damaging 1.00
R1850:Lepr UTSW 4 101733423 missense possibly damaging 0.67
R1918:Lepr UTSW 4 101772836 missense probably benign 0.08
R1928:Lepr UTSW 4 101782730 splice site probably benign
R2099:Lepr UTSW 4 101772988 missense probably damaging 1.00
R2102:Lepr UTSW 4 101772981 missense possibly damaging 0.95
R2175:Lepr UTSW 4 101765379 missense probably benign 0.01
R2254:Lepr UTSW 4 101815112 missense probably benign 0.26
R2396:Lepr UTSW 4 101733528 missense probably benign 0.19
R2508:Lepr UTSW 4 101790896 missense probably damaging 0.98
R2571:Lepr UTSW 4 101768172 missense possibly damaging 0.96
R3790:Lepr UTSW 4 101790914 splice site probably benign
R3882:Lepr UTSW 4 101815265 missense probably damaging 1.00
R3933:Lepr UTSW 4 101765301 splice site probably benign
R4211:Lepr UTSW 4 101733414 missense probably benign 0.19
R4343:Lepr UTSW 4 101765152 critical splice donor site probably null
R4345:Lepr UTSW 4 101765152 critical splice donor site probably null
R4544:Lepr UTSW 4 101768228 missense possibly damaging 0.96
R4546:Lepr UTSW 4 101814641 missense probably benign 0.35
R4724:Lepr UTSW 4 101765365 nonsense probably null
R4797:Lepr UTSW 4 101780047 missense possibly damaging 0.90
R4860:Lepr UTSW 4 101789337 missense probably benign 0.14
R4860:Lepr UTSW 4 101789337 missense probably benign 0.14
R4929:Lepr UTSW 4 101815117 missense probably benign 0.00
R4939:Lepr UTSW 4 101733438 missense possibly damaging 0.78
R5377:Lepr UTSW 4 101815019 missense possibly damaging 0.71
R5520:Lepr UTSW 4 101745537 missense probably benign 0.00
R5966:Lepr UTSW 4 101792127 intron probably benign
R6092:Lepr UTSW 4 101792023 missense probably damaging 1.00
R6168:Lepr UTSW 4 101735592 missense probably damaging 0.99
R6232:Lepr UTSW 4 101814391 intron probably null
R6380:Lepr UTSW 4 101764954 nonsense probably null
R6427:Lepr UTSW 4 101774257 missense possibly damaging 0.47
R6428:Lepr UTSW 4 101780098 missense probably damaging 1.00
R6641:Lepr UTSW 4 101765305 missense probably damaging 0.97
R6650:Lepr UTSW 4 101815201 missense probably damaging 1.00
R6859:Lepr UTSW 4 101765290 splice site probably null
R7023:Lepr UTSW 4 101789287 missense probably damaging 1.00
R7145:Lepr UTSW 4 101752197 missense probably benign 0.00
R7174:Lepr UTSW 4 101750338 missense probably benign 0.01
R7179:Lepr UTSW 4 101745659 missense probably benign 0.06
R7189:Lepr UTSW 4 101814764 missense probably benign 0.00
R7426:Lepr UTSW 4 101745656 missense probably benign 0.03
R7531:Lepr UTSW 4 101752175 missense probably damaging 1.00
R7620:Lepr UTSW 4 101752073 missense probably benign 0.41
R7804:Lepr UTSW 4 101782586 missense probably damaging 1.00
X0026:Lepr UTSW 4 101733327 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- CATGGACTGCGTTAGAGTCC -3'
(R):5'- TTGCATGCCACTCAAAAGCC -3'

Sequencing Primer
(F):5'- GCGTTAGAGTCCTACTAAAGATGCC -3'
(R):5'- GCCTTGGGTGTAAATTTTTCAAAG -3'
Posted On2017-10-10