Incidental Mutation 'R6130:Fbxo6'
ID487080
Institutional Source Beutler Lab
Gene Symbol Fbxo6
Ensembl Gene ENSMUSG00000055401
Gene NameF-box protein 6
SynonymsFbx6b, FBG2, Fbs2, Fbxo6b
MMRRC Submission 044277-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R6130 (G1)
Quality Score180.009
Status Validated
Chromosome4
Chromosomal Location148145716-148152140 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 148149522 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 39 (I39N)
Ref Sequence ENSEMBL: ENSMUSP00000130188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030858] [ENSMUST00000030860] [ENSMUST00000056965] [ENSMUST00000057907] [ENSMUST00000084129] [ENSMUST00000105705] [ENSMUST00000105706] [ENSMUST00000105707] [ENSMUST00000126615] [ENSMUST00000129253] [ENSMUST00000132083] [ENSMUST00000132698] [ENSMUST00000134261] [ENSMUST00000140049] [ENSMUST00000151246] [ENSMUST00000152098] [ENSMUST00000167160] [ENSMUST00000168503] [ENSMUST00000172472]
Predicted Effect probably damaging
Transcript: ENSMUST00000030858
AA Change: I39N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030858
Gene: ENSMUSG00000055401
AA Change: I39N

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000030860
SMART Domains Protein: ENSMUSP00000030860
Gene: ENSMUSG00000029003

DomainStartEndE-ValueType
Pfam:HORMA 12 184 1e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000056965
AA Change: I39N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062348
Gene: ENSMUSG00000055401
AA Change: I39N

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000057907
SMART Domains Protein: ENSMUSP00000054022
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 252 2.24e-110 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084129
SMART Domains Protein: ENSMUSP00000081146
Gene: ENSMUSG00000029003

DomainStartEndE-ValueType
Pfam:HORMA 13 167 4.2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105705
SMART Domains Protein: ENSMUSP00000101330
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 196 2.79e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105706
AA Change: I39N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101331
Gene: ENSMUSG00000055401
AA Change: I39N

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105707
SMART Domains Protein: ENSMUSP00000101332
Gene: ENSMUSG00000029003

DomainStartEndE-ValueType
Pfam:HORMA 13 171 4.3e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105708
Predicted Effect probably damaging
Transcript: ENSMUST00000126615
AA Change: I39N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120801
Gene: ENSMUSG00000055401
AA Change: I39N

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 237 1.39e-97 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129253
SMART Domains Protein: ENSMUSP00000117013
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 213 1.15e-57 SMART
Predicted Effect unknown
Transcript: ENSMUST00000132083
AA Change: I39N
SMART Domains Protein: ENSMUSP00000120431
Gene: ENSMUSG00000055401
AA Change: I39N

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132698
SMART Domains Protein: ENSMUSP00000122774
Gene: ENSMUSG00000029003

DomainStartEndE-ValueType
Pfam:HORMA 12 168 2e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000134261
AA Change: I39N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123132
Gene: ENSMUSG00000055401
AA Change: I39N

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 228 1.89e-85 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140049
SMART Domains Protein: ENSMUSP00000120481
Gene: ENSMUSG00000029003

DomainStartEndE-ValueType
PDB:4FJO|C 32 107 1e-47 PDB
SCOP:d1go4a_ 32 107 1e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151246
SMART Domains Protein: ENSMUSP00000114571
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 231 1.43e-85 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000152098
AA Change: I39N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121379
Gene: ENSMUSG00000055401
AA Change: I39N

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153703
SMART Domains Protein: ENSMUSP00000115937
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBA 1 143 3.11e-54 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167160
SMART Domains Protein: ENSMUSP00000126551
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 252 2.24e-110 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168503
AA Change: I39N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130188
Gene: ENSMUSG00000055401
AA Change: I39N

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172472
SMART Domains Protein: ENSMUSP00000133966
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
Pfam:FBA 68 126 3.4e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183749
Meta Mutation Damage Score 0.8724 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class, and its C-terminal region is highly similar to that of rat NFB42 (neural F Box 42 kDa) which may be involved in the control of the cell cycle. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abi3 T A 11: 95,837,095 E90V probably damaging Het
Adgrv1 A C 13: 81,427,745 V4834G probably damaging Het
Aen A T 7: 78,902,639 probably null Het
Ankrd55 A G 13: 112,318,446 D26G probably damaging Het
Antxr2 T C 5: 98,004,272 E160G possibly damaging Het
Auts2 T C 5: 131,440,223 H528R probably damaging Het
Casd1 A G 6: 4,641,948 T742A probably damaging Het
Ccdc39 T C 3: 33,841,192 probably null Het
Ctla4 T C 1: 60,912,491 Y60H probably damaging Het
Dennd4b T C 3: 90,276,259 L935P probably damaging Het
Dnah6 T A 6: 73,188,494 T543S probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Fdxacb1 C T 9: 50,772,602 R420* probably null Het
Flg A G 3: 93,292,716 probably benign Het
Fpr1 T A 17: 17,877,635 I31F probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gsta1 T A 9: 78,242,565 F220Y probably damaging Het
Hmg20a T A 9: 56,488,607 probably null Het
Igf2bp1 A C 11: 95,974,020 L201R probably damaging Het
Jph3 G A 8: 121,753,087 R168H probably damaging Het
Kif1a T A 1: 93,036,901 I1318F probably damaging Het
Lamc2 T C 1: 153,136,777 N717S probably benign Het
Lepr A T 4: 101,765,372 S450C probably damaging Het
Muc16 A G 9: 18,590,698 V6535A probably damaging Het
Myom3 A G 4: 135,762,571 T18A probably benign Het
Nlrp5 A G 7: 23,404,173 K22E probably benign Het
Obscn A C 11: 59,077,945 S2534A possibly damaging Het
Olfr318 A G 11: 58,720,307 V247A probably damaging Het
Olfr50 A T 2: 36,794,043 D269V probably benign Het
Pcdhga8 T A 18: 37,727,527 N545K possibly damaging Het
Pcsk5 A T 19: 17,511,556 Y967N probably damaging Het
Ppp1r32 G A 19: 10,477,764 P233L probably benign Het
Robo2 C T 16: 73,920,682 G100S probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Scap A G 9: 110,380,379 T707A possibly damaging Het
Scarf1 A G 11: 75,525,739 Q669R probably benign Het
Scin T C 12: 40,069,436 D531G probably benign Het
Sh2b3 T C 5: 121,815,563 probably null Het
Slco1a6 T C 6: 142,086,429 S657G probably benign Het
Stil T A 4: 115,029,861 probably null Het
Syna T A 5: 134,558,268 Q609L possibly damaging Het
Tmem59l A G 8: 70,484,605 S271P probably damaging Het
Tns2 A G 15: 102,111,241 E522G probably damaging Het
Trappc6a G A 7: 19,515,294 A149T probably benign Het
Trim21 A T 7: 102,563,291 L156H possibly damaging Het
Trpv3 A G 11: 73,296,483 R714G possibly damaging Het
Wdr63 A C 3: 146,042,804 Y852D probably benign Het
Zfp72 T A 13: 74,372,341 Q206L possibly damaging Het
Other mutations in Fbxo6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Fbxo6 APN 4 148146143 missense probably damaging 1.00
IGL00940:Fbxo6 APN 4 148146110 missense probably benign 0.05
IGL02996:Fbxo6 APN 4 148146891 missense probably damaging 1.00
IGL03034:Fbxo6 APN 4 148146122 nonsense probably null
R0556:Fbxo6 UTSW 4 148146175 missense probably damaging 1.00
R1475:Fbxo6 UTSW 4 148146110 missense probably benign 0.05
R1482:Fbxo6 UTSW 4 148145984 nonsense probably null
R1986:Fbxo6 UTSW 4 148146095 missense probably damaging 1.00
R3742:Fbxo6 UTSW 4 148149633 unclassified probably benign
R4994:Fbxo6 UTSW 4 148149491 missense probably damaging 0.99
R6102:Fbxo6 UTSW 4 148149522 missense probably damaging 1.00
R6103:Fbxo6 UTSW 4 148149522 missense probably damaging 1.00
R6104:Fbxo6 UTSW 4 148149522 missense probably damaging 1.00
R6105:Fbxo6 UTSW 4 148149522 missense probably damaging 1.00
R6129:Fbxo6 UTSW 4 148149522 missense probably damaging 1.00
R6212:Fbxo6 UTSW 4 148149522 missense probably damaging 1.00
R6220:Fbxo6 UTSW 4 148149522 missense probably damaging 1.00
R6392:Fbxo6 UTSW 4 148146005 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCGTTAGCTAGCGTGGACAG -3'
(R):5'- GTTTCAGGTCCTCAGCTCAC -3'

Sequencing Primer
(F):5'- TAAAGAAGGCTCCCAGGGCTC -3'
(R):5'- AGGTCCTCAGCTCACTGTCTTC -3'
Posted On2017-10-10