Incidental Mutation 'R6130:Tmem59l'
ID487092
Institutional Source Beutler Lab
Gene Symbol Tmem59l
Ensembl Gene ENSMUSG00000035964
Gene Nametransmembrane protein 59-like
Synonyms
MMRRC Submission 044277-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R6130 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location70483867-70487358 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70484605 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 271 (S271P)
Ref Sequence ENSEMBL: ENSMUSP00000043659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045286]
Predicted Effect probably damaging
Transcript: ENSMUST00000045286
AA Change: S271P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043659
Gene: ENSMUSG00000035964
AA Change: S271P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 33 41 N/A INTRINSIC
low complexity region 44 60 N/A INTRINSIC
Pfam:BSMAP 72 278 1e-67 PFAM
low complexity region 311 319 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211264
Meta Mutation Damage Score 0.3787 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a predicted type-I membrane glycoprotein. The encoded protein may play a role in functioning of the central nervous system. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abi3 T A 11: 95,837,095 E90V probably damaging Het
Adgrv1 A C 13: 81,427,745 V4834G probably damaging Het
Aen A T 7: 78,902,639 probably null Het
Ankrd55 A G 13: 112,318,446 D26G probably damaging Het
Antxr2 T C 5: 98,004,272 E160G possibly damaging Het
Auts2 T C 5: 131,440,223 H528R probably damaging Het
Casd1 A G 6: 4,641,948 T742A probably damaging Het
Ccdc39 T C 3: 33,841,192 probably null Het
Ctla4 T C 1: 60,912,491 Y60H probably damaging Het
Dennd4b T C 3: 90,276,259 L935P probably damaging Het
Dnah6 T A 6: 73,188,494 T543S probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Fdxacb1 C T 9: 50,772,602 R420* probably null Het
Flg A G 3: 93,292,716 probably benign Het
Fpr1 T A 17: 17,877,635 I31F probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gsta1 T A 9: 78,242,565 F220Y probably damaging Het
Hmg20a T A 9: 56,488,607 probably null Het
Igf2bp1 A C 11: 95,974,020 L201R probably damaging Het
Jph3 G A 8: 121,753,087 R168H probably damaging Het
Kif1a T A 1: 93,036,901 I1318F probably damaging Het
Lamc2 T C 1: 153,136,777 N717S probably benign Het
Lepr A T 4: 101,765,372 S450C probably damaging Het
Muc16 A G 9: 18,590,698 V6535A probably damaging Het
Myom3 A G 4: 135,762,571 T18A probably benign Het
Nlrp5 A G 7: 23,404,173 K22E probably benign Het
Obscn A C 11: 59,077,945 S2534A possibly damaging Het
Olfr318 A G 11: 58,720,307 V247A probably damaging Het
Olfr50 A T 2: 36,794,043 D269V probably benign Het
Pcdhga8 T A 18: 37,727,527 N545K possibly damaging Het
Pcsk5 A T 19: 17,511,556 Y967N probably damaging Het
Ppp1r32 G A 19: 10,477,764 P233L probably benign Het
Robo2 C T 16: 73,920,682 G100S probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Scap A G 9: 110,380,379 T707A possibly damaging Het
Scarf1 A G 11: 75,525,739 Q669R probably benign Het
Scin T C 12: 40,069,436 D531G probably benign Het
Sh2b3 T C 5: 121,815,563 probably null Het
Slco1a6 T C 6: 142,086,429 S657G probably benign Het
Stil T A 4: 115,029,861 probably null Het
Syna T A 5: 134,558,268 Q609L possibly damaging Het
Tns2 A G 15: 102,111,241 E522G probably damaging Het
Trappc6a G A 7: 19,515,294 A149T probably benign Het
Trim21 A T 7: 102,563,291 L156H possibly damaging Het
Trpv3 A G 11: 73,296,483 R714G possibly damaging Het
Wdr63 A C 3: 146,042,804 Y852D probably benign Het
Zfp72 T A 13: 74,372,341 Q206L possibly damaging Het
Other mutations in Tmem59l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00903:Tmem59l APN 8 70485665 splice site probably benign
IGL01479:Tmem59l APN 8 70486098 missense probably benign 0.00
IGL01783:Tmem59l APN 8 70487224 missense probably damaging 1.00
IGL01998:Tmem59l APN 8 70484781 missense probably benign 0.16
R0973:Tmem59l UTSW 8 70486060 missense possibly damaging 0.93
R0973:Tmem59l UTSW 8 70486060 missense possibly damaging 0.93
R0974:Tmem59l UTSW 8 70486060 missense possibly damaging 0.93
R1201:Tmem59l UTSW 8 70484387 nonsense probably null
R1540:Tmem59l UTSW 8 70485154 missense probably benign 0.05
R1775:Tmem59l UTSW 8 70486253 missense probably damaging 1.00
R2217:Tmem59l UTSW 8 70487301 missense unknown
R2238:Tmem59l UTSW 8 70485122 missense probably damaging 0.99
R2313:Tmem59l UTSW 8 70487301 missense unknown
R2315:Tmem59l UTSW 8 70487301 missense unknown
R2969:Tmem59l UTSW 8 70487301 missense unknown
R2970:Tmem59l UTSW 8 70487301 missense unknown
R3011:Tmem59l UTSW 8 70486237 missense probably damaging 1.00
R3725:Tmem59l UTSW 8 70487301 missense unknown
R3726:Tmem59l UTSW 8 70487301 missense unknown
R3774:Tmem59l UTSW 8 70487301 missense unknown
R3775:Tmem59l UTSW 8 70487301 missense unknown
R3826:Tmem59l UTSW 8 70487301 missense unknown
R3827:Tmem59l UTSW 8 70487301 missense unknown
R3828:Tmem59l UTSW 8 70487301 missense unknown
R3829:Tmem59l UTSW 8 70487301 missense unknown
R3851:Tmem59l UTSW 8 70487301 missense unknown
R3943:Tmem59l UTSW 8 70487301 missense unknown
R3944:Tmem59l UTSW 8 70487301 missense unknown
R4064:Tmem59l UTSW 8 70485719 missense probably damaging 1.00
R4409:Tmem59l UTSW 8 70487301 missense unknown
R4410:Tmem59l UTSW 8 70487301 missense unknown
R4422:Tmem59l UTSW 8 70486099 missense probably damaging 0.98
R4470:Tmem59l UTSW 8 70487301 missense unknown
R4471:Tmem59l UTSW 8 70487301 missense unknown
R4767:Tmem59l UTSW 8 70486098 missense probably benign 0.00
R5321:Tmem59l UTSW 8 70487215 missense probably damaging 1.00
R6527:Tmem59l UTSW 8 70486125 missense probably damaging 1.00
R6603:Tmem59l UTSW 8 70486356 missense probably benign 0.31
R6750:Tmem59l UTSW 8 70486372 missense probably benign 0.34
R7542:Tmem59l UTSW 8 70485164 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- AGTCAGACTCCACCAAGAGG -3'
(R):5'- CCAGCAAAGCCAAGGTAGAGTC -3'

Sequencing Primer
(F):5'- CAAGAGGCCCTTGTGCTGTTC -3'
(R):5'- CTGAGGACCAACAAGAGAGTGACTTC -3'
Posted On2017-10-10