Incidental Mutation 'R6130:Trpv3'
ID487100
Institutional Source Beutler Lab
Gene Symbol Trpv3
Ensembl Gene ENSMUSG00000043029
Gene Nametransient receptor potential cation channel, subfamily V, member 3
SynonymsNh, VRL3, 1110036I10Rik
MMRRC Submission 044277-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R6130 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location73267388-73300363 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73296483 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 714 (R714G)
Ref Sequence ENSEMBL: ENSMUSP00000053755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049676]
AlphaFold Q8K424
PDB Structure Crystal structure of the N-terminal ankyrin repeat domain of TRPV3 [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049676
AA Change: R714G

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000053755
Gene: ENSMUSG00000043029
AA Change: R714G

DomainStartEndE-ValueType
low complexity region 81 92 N/A INTRINSIC
low complexity region 109 122 N/A INTRINSIC
low complexity region 133 153 N/A INTRINSIC
ANK 167 201 1.21e2 SMART
ANK 214 243 3.54e-1 SMART
ANK 261 291 1.36e-2 SMART
ANK 340 370 6.71e-2 SMART
low complexity region 417 431 N/A INTRINSIC
Pfam:Ion_trans 437 689 3.9e-9 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to a family of nonselective cation channels that function in a variety of processes, including temperature sensation and vasoregulation. The thermosensitive members of this family are expressed in subsets of sensory neurons that terminate in the skin, and are activated at distinct physiological temperatures. This channel is activated at temperatures between 22 and 40 degrees C. This gene lies in close proximity to another family member gene on chromosome 17, and the two encoded proteins are thought to associate with each other to form heteromeric channels. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygous null mice have strong deficits in response to innocuous and noxious heat but not in other sensory modalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abi3 T A 11: 95,837,095 E90V probably damaging Het
Adgrv1 A C 13: 81,427,745 V4834G probably damaging Het
Aen A T 7: 78,902,639 probably null Het
Ankrd55 A G 13: 112,318,446 D26G probably damaging Het
Antxr2 T C 5: 98,004,272 E160G possibly damaging Het
Auts2 T C 5: 131,440,223 H528R probably damaging Het
Casd1 A G 6: 4,641,948 T742A probably damaging Het
Ccdc39 T C 3: 33,841,192 probably null Het
Ctla4 T C 1: 60,912,491 Y60H probably damaging Het
Dennd4b T C 3: 90,276,259 L935P probably damaging Het
Dnah6 T A 6: 73,188,494 T543S probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Fdxacb1 C T 9: 50,772,602 R420* probably null Het
Flg A G 3: 93,292,716 probably benign Het
Fpr1 T A 17: 17,877,635 I31F probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gsta1 T A 9: 78,242,565 F220Y probably damaging Het
Hmg20a T A 9: 56,488,607 probably null Het
Igf2bp1 A C 11: 95,974,020 L201R probably damaging Het
Jph3 G A 8: 121,753,087 R168H probably damaging Het
Kif1a T A 1: 93,036,901 I1318F probably damaging Het
Lamc2 T C 1: 153,136,777 N717S probably benign Het
Lepr A T 4: 101,765,372 S450C probably damaging Het
Muc16 A G 9: 18,590,698 V6535A probably damaging Het
Myom3 A G 4: 135,762,571 T18A probably benign Het
Nlrp5 A G 7: 23,404,173 K22E probably benign Het
Obscn A C 11: 59,077,945 S2534A possibly damaging Het
Olfr318 A G 11: 58,720,307 V247A probably damaging Het
Olfr50 A T 2: 36,794,043 D269V probably benign Het
Pcdhga8 T A 18: 37,727,527 N545K possibly damaging Het
Pcsk5 A T 19: 17,511,556 Y967N probably damaging Het
Ppp1r32 G A 19: 10,477,764 P233L probably benign Het
Robo2 C T 16: 73,920,682 G100S probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Scap A G 9: 110,380,379 T707A possibly damaging Het
Scarf1 A G 11: 75,525,739 Q669R probably benign Het
Scin T C 12: 40,069,436 D531G probably benign Het
Sh2b3 T C 5: 121,815,563 probably null Het
Slco1a6 T C 6: 142,086,429 S657G probably benign Het
Stil T A 4: 115,029,861 probably null Het
Syna T A 5: 134,558,268 Q609L possibly damaging Het
Tmem59l A G 8: 70,484,605 S271P probably damaging Het
Tns2 A G 15: 102,111,241 E522G probably damaging Het
Trappc6a G A 7: 19,515,294 A149T probably benign Het
Trim21 A T 7: 102,563,291 L156H possibly damaging Het
Wdr63 A C 3: 146,042,804 Y852D probably benign Het
Zfp72 T A 13: 74,372,341 Q206L possibly damaging Het
Other mutations in Trpv3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Trpv3 APN 11 73294000 critical splice donor site probably null
IGL01161:Trpv3 APN 11 73296718 splice site probably benign
IGL02130:Trpv3 APN 11 73279770 missense probably benign 0.00
IGL02957:Trpv3 APN 11 73285872 missense probably damaging 1.00
IGL03334:Trpv3 APN 11 73281665 splice site probably benign
R0103:Trpv3 UTSW 11 73293979 missense probably damaging 1.00
R0103:Trpv3 UTSW 11 73293979 missense probably damaging 1.00
R0546:Trpv3 UTSW 11 73297187 missense probably damaging 1.00
R0685:Trpv3 UTSW 11 73296814 splice site probably benign
R0969:Trpv3 UTSW 11 73278938 nonsense probably null
R1748:Trpv3 UTSW 11 73295383 missense possibly damaging 0.84
R1974:Trpv3 UTSW 11 73283688 missense probably damaging 0.99
R2015:Trpv3 UTSW 11 73279827 missense probably damaging 0.97
R3426:Trpv3 UTSW 11 73285941 missense probably damaging 1.00
R3427:Trpv3 UTSW 11 73285941 missense probably damaging 1.00
R3428:Trpv3 UTSW 11 73285941 missense probably damaging 1.00
R3618:Trpv3 UTSW 11 73295455 missense probably damaging 1.00
R3712:Trpv3 UTSW 11 73278954 missense probably benign
R3916:Trpv3 UTSW 11 73283734 missense possibly damaging 0.87
R3917:Trpv3 UTSW 11 73283734 missense possibly damaging 0.87
R3961:Trpv3 UTSW 11 73287420 nonsense probably null
R4242:Trpv3 UTSW 11 73277823 missense probably benign 0.43
R4277:Trpv3 UTSW 11 73296438 missense probably damaging 0.97
R4506:Trpv3 UTSW 11 73295324 missense probably benign 0.40
R4629:Trpv3 UTSW 11 73281789 missense probably damaging 0.99
R4656:Trpv3 UTSW 11 73295414 missense probably damaging 1.00
R5059:Trpv3 UTSW 11 73295323 missense probably benign 0.00
R5121:Trpv3 UTSW 11 73277834 critical splice donor site probably null
R6113:Trpv3 UTSW 11 73286018 missense probably benign 0.10
R6342:Trpv3 UTSW 11 73283863 missense probably damaging 1.00
R6850:Trpv3 UTSW 11 73291693 missense probably damaging 1.00
R7180:Trpv3 UTSW 11 73277992 missense probably benign
R7434:Trpv3 UTSW 11 73288261 missense probably damaging 0.96
R7440:Trpv3 UTSW 11 73277974 missense probably benign 0.37
R7741:Trpv3 UTSW 11 73288262 missense probably damaging 0.99
R7750:Trpv3 UTSW 11 73286021 missense probably damaging 0.99
R7785:Trpv3 UTSW 11 73277732 missense probably benign 0.43
R8309:Trpv3 UTSW 11 73279921 missense probably damaging 1.00
R8354:Trpv3 UTSW 11 73291622 missense probably damaging 1.00
R8383:Trpv3 UTSW 11 73289301 missense probably benign 0.30
R8443:Trpv3 UTSW 11 73295383 missense possibly damaging 0.84
R8454:Trpv3 UTSW 11 73291622 missense probably damaging 1.00
R8492:Trpv3 UTSW 11 73288209 nonsense probably null
R8556:Trpv3 UTSW 11 73287465 missense probably benign
R8701:Trpv3 UTSW 11 73278936 missense possibly damaging 0.84
R9046:Trpv3 UTSW 11 73285872 missense probably damaging 1.00
Z1186:Trpv3 UTSW 11 73269687 missense probably benign
Z1186:Trpv3 UTSW 11 73278977 missense probably benign
Z1186:Trpv3 UTSW 11 73283676 missense probably benign
Z1187:Trpv3 UTSW 11 73269687 missense probably benign
Z1187:Trpv3 UTSW 11 73278977 missense probably benign
Z1187:Trpv3 UTSW 11 73283676 missense probably benign
Z1188:Trpv3 UTSW 11 73269687 missense probably benign
Z1188:Trpv3 UTSW 11 73278977 missense probably benign
Z1188:Trpv3 UTSW 11 73283676 missense probably benign
Z1189:Trpv3 UTSW 11 73269687 missense probably benign
Z1189:Trpv3 UTSW 11 73278977 missense probably benign
Z1189:Trpv3 UTSW 11 73283676 missense probably benign
Z1190:Trpv3 UTSW 11 73269687 missense probably benign
Z1190:Trpv3 UTSW 11 73278977 missense probably benign
Z1190:Trpv3 UTSW 11 73283676 missense probably benign
Z1191:Trpv3 UTSW 11 73269687 missense probably benign
Z1191:Trpv3 UTSW 11 73278977 missense probably benign
Z1191:Trpv3 UTSW 11 73283676 missense probably benign
Z1192:Trpv3 UTSW 11 73269687 missense probably benign
Z1192:Trpv3 UTSW 11 73278977 missense probably benign
Z1192:Trpv3 UTSW 11 73283676 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTTTAAGCACAAATGAGGCTGG -3'
(R):5'- CACTGCTTCGGAATCACATCTC -3'

Sequencing Primer
(F):5'- TGAGGCTGGAGTGAGGTAGC -3'
(R):5'- ACACACACATTTGGGATGTCC -3'
Posted On2017-10-10