Incidental Mutation 'R6130:Igf2bp1'
ID487103
Institutional Source Beutler Lab
Gene Symbol Igf2bp1
Ensembl Gene ENSMUSG00000013415
Gene Nameinsulin-like growth factor 2 mRNA binding protein 1
SynonymsIMP-1, Zbp1, D030026A21Rik, D11Moh45, CRD-BP, D11Moh40e, Crdbp
MMRRC Submission 044277-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R6130 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location95957163-96005940 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 95974020 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 201 (L201R)
Ref Sequence ENSEMBL: ENSMUSP00000013559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013559]
Predicted Effect probably damaging
Transcript: ENSMUST00000013559
AA Change: L201R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000013559
Gene: ENSMUSG00000013415
AA Change: L201R

DomainStartEndE-ValueType
RRM 3 71 7.42e-9 SMART
RRM 82 152 5.25e-9 SMART
KH 194 265 7.75e-14 SMART
KH 275 348 7.34e-15 SMART
low complexity region 377 390 N/A INTRINSIC
KH 404 475 1.91e-13 SMART
KH 486 558 1.42e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146586
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152896
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the insulin-like growth factor 2 mRNA-binding protein family. The protein encoded by this gene contains four K homology domains and two RNA recognition motifs. It functions by binding to the mRNAs of certain genes, including insulin-like growth factor 2, beta-actin and beta-transducin repeat-containing protein, and regulating their translation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous mutation of this locus results in increased neonatal lethality, growth retardation, and impaired intestinal development. Males exhibit increased anxiety-like response and decreased exploratory behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abi3 T A 11: 95,837,095 E90V probably damaging Het
Adgrv1 A C 13: 81,427,745 V4834G probably damaging Het
Aen A T 7: 78,902,639 probably null Het
Ankrd55 A G 13: 112,318,446 D26G probably damaging Het
Antxr2 T C 5: 98,004,272 E160G possibly damaging Het
Auts2 T C 5: 131,440,223 H528R probably damaging Het
Casd1 A G 6: 4,641,948 T742A probably damaging Het
Ccdc39 T C 3: 33,841,192 probably null Het
Ctla4 T C 1: 60,912,491 Y60H probably damaging Het
Dennd4b T C 3: 90,276,259 L935P probably damaging Het
Dnah6 T A 6: 73,188,494 T543S probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Fdxacb1 C T 9: 50,772,602 R420* probably null Het
Flg A G 3: 93,292,716 probably benign Het
Fpr1 T A 17: 17,877,635 I31F probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gsta1 T A 9: 78,242,565 F220Y probably damaging Het
Hmg20a T A 9: 56,488,607 probably null Het
Jph3 G A 8: 121,753,087 R168H probably damaging Het
Kif1a T A 1: 93,036,901 I1318F probably damaging Het
Lamc2 T C 1: 153,136,777 N717S probably benign Het
Lepr A T 4: 101,765,372 S450C probably damaging Het
Muc16 A G 9: 18,590,698 V6535A probably damaging Het
Myom3 A G 4: 135,762,571 T18A probably benign Het
Nlrp5 A G 7: 23,404,173 K22E probably benign Het
Obscn A C 11: 59,077,945 S2534A possibly damaging Het
Olfr318 A G 11: 58,720,307 V247A probably damaging Het
Olfr50 A T 2: 36,794,043 D269V probably benign Het
Pcdhga8 T A 18: 37,727,527 N545K possibly damaging Het
Pcsk5 A T 19: 17,511,556 Y967N probably damaging Het
Ppp1r32 G A 19: 10,477,764 P233L probably benign Het
Robo2 C T 16: 73,920,682 G100S probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Scap A G 9: 110,380,379 T707A possibly damaging Het
Scarf1 A G 11: 75,525,739 Q669R probably benign Het
Scin T C 12: 40,069,436 D531G probably benign Het
Sh2b3 T C 5: 121,815,563 probably null Het
Slco1a6 T C 6: 142,086,429 S657G probably benign Het
Stil T A 4: 115,029,861 probably null Het
Syna T A 5: 134,558,268 Q609L possibly damaging Het
Tmem59l A G 8: 70,484,605 S271P probably damaging Het
Tns2 A G 15: 102,111,241 E522G probably damaging Het
Trappc6a G A 7: 19,515,294 A149T probably benign Het
Trim21 A T 7: 102,563,291 L156H possibly damaging Het
Trpv3 A G 11: 73,296,483 R714G possibly damaging Het
Wdr63 A C 3: 146,042,804 Y852D probably benign Het
Zfp72 T A 13: 74,372,341 Q206L possibly damaging Het
Other mutations in Igf2bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02554:Igf2bp1 APN 11 95974168 missense probably damaging 0.97
IGL03263:Igf2bp1 APN 11 95966673 missense probably damaging 1.00
R0011:Igf2bp1 UTSW 11 96005584 missense probably damaging 0.96
R0011:Igf2bp1 UTSW 11 96005584 missense probably damaging 0.96
R0098:Igf2bp1 UTSW 11 95973163 missense probably damaging 1.00
R0348:Igf2bp1 UTSW 11 95968893 missense possibly damaging 0.59
R0534:Igf2bp1 UTSW 11 95966796 splice site probably benign
R2025:Igf2bp1 UTSW 11 95974170 missense possibly damaging 0.95
R2026:Igf2bp1 UTSW 11 95974170 missense possibly damaging 0.95
R2103:Igf2bp1 UTSW 11 95975296 missense probably damaging 0.96
R2104:Igf2bp1 UTSW 11 95975296 missense probably damaging 0.96
R5021:Igf2bp1 UTSW 11 95974006 missense probably damaging 0.98
R5154:Igf2bp1 UTSW 11 95963547 nonsense probably null
R6123:Igf2bp1 UTSW 11 95975296 missense probably damaging 0.96
R6736:Igf2bp1 UTSW 11 95973122 missense probably benign 0.14
R7173:Igf2bp1 UTSW 11 95968464 missense probably benign
R7748:Igf2bp1 UTSW 11 95967587 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGACAAAAGTGCTGATGCCC -3'
(R):5'- GTGACCATTGGACTCCCTGTTC -3'

Sequencing Primer
(F):5'- TGCCCAAACCAAGTGTTTTCAAGG -3'
(R):5'- CTGTTCCTAGAGCTATCATGAAGC -3'
Posted On2017-10-10