Incidental Mutation 'R6130:Ppp1r32'
ID487112
Institutional Source Beutler Lab
Gene Symbol Ppp1r32
Ensembl Gene ENSMUSG00000035179
Gene Nameprotein phosphatase 1, regulatory subunit 32
SynonymsIIIG9L, 4930579J09Rik, IIIG9S, IIIG9
MMRRC Submission 044277-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6130 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location10474257-10482897 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 10477764 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 233 (P233L)
Ref Sequence ENSEMBL: ENSMUSP00000035684 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000038842
AA Change: P233L

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 96% (46/48)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abi3 T A 11: 95,837,095 E90V probably damaging Het
Adgrv1 A C 13: 81,427,745 V4834G probably damaging Het
Aen A T 7: 78,902,639 probably null Het
Ankrd55 A G 13: 112,318,446 D26G probably damaging Het
Antxr2 T C 5: 98,004,272 E160G possibly damaging Het
Auts2 T C 5: 131,440,223 H528R probably damaging Het
Casd1 A G 6: 4,641,948 T742A probably damaging Het
Ccdc39 T C 3: 33,841,192 probably null Het
Ctla4 T C 1: 60,912,491 Y60H probably damaging Het
Dennd4b T C 3: 90,276,259 L935P probably damaging Het
Dnah6 T A 6: 73,188,494 T543S probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Fdxacb1 C T 9: 50,772,602 R420* probably null Het
Flg A G 3: 93,292,716 probably benign Het
Fpr1 T A 17: 17,877,635 I31F probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gsta1 T A 9: 78,242,565 F220Y probably damaging Het
Hmg20a T A 9: 56,488,607 probably null Het
Igf2bp1 A C 11: 95,974,020 L201R probably damaging Het
Jph3 G A 8: 121,753,087 R168H probably damaging Het
Kif1a T A 1: 93,036,901 I1318F probably damaging Het
Lamc2 T C 1: 153,136,777 N717S probably benign Het
Lepr A T 4: 101,765,372 S450C probably damaging Het
Muc16 A G 9: 18,590,698 V6535A probably damaging Het
Myom3 A G 4: 135,762,571 T18A probably benign Het
Nlrp5 A G 7: 23,404,173 K22E probably benign Het
Obscn A C 11: 59,077,945 S2534A possibly damaging Het
Olfr318 A G 11: 58,720,307 V247A probably damaging Het
Olfr50 A T 2: 36,794,043 D269V probably benign Het
Pcdhga8 T A 18: 37,727,527 N545K possibly damaging Het
Pcsk5 A T 19: 17,511,556 Y967N probably damaging Het
Robo2 C T 16: 73,920,682 G100S probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Scap A G 9: 110,380,379 T707A possibly damaging Het
Scarf1 A G 11: 75,525,739 Q669R probably benign Het
Scin T C 12: 40,069,436 D531G probably benign Het
Sh2b3 T C 5: 121,815,563 probably null Het
Slco1a6 T C 6: 142,086,429 S657G probably benign Het
Stil T A 4: 115,029,861 probably null Het
Syna T A 5: 134,558,268 Q609L possibly damaging Het
Tmem59l A G 8: 70,484,605 S271P probably damaging Het
Tns2 A G 15: 102,111,241 E522G probably damaging Het
Trappc6a G A 7: 19,515,294 A149T probably benign Het
Trim21 A T 7: 102,563,291 L156H possibly damaging Het
Trpv3 A G 11: 73,296,483 R714G possibly damaging Het
Wdr63 A C 3: 146,042,804 Y852D probably benign Het
Zfp72 T A 13: 74,372,341 Q206L possibly damaging Het
Other mutations in Ppp1r32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Ppp1r32 APN 19 10477523 critical splice donor site probably null
IGL00979:Ppp1r32 APN 19 10474499 makesense probably null
IGL02405:Ppp1r32 APN 19 10474566 missense probably damaging 1.00
IGL02664:Ppp1r32 APN 19 10482291 missense probably damaging 1.00
IGL03105:Ppp1r32 APN 19 10477020 splice site probably benign
R0255:Ppp1r32 UTSW 19 10475054 missense probably damaging 1.00
R0268:Ppp1r32 UTSW 19 10477085 missense possibly damaging 0.88
R1018:Ppp1r32 UTSW 19 10479460 splice site probably benign
R1559:Ppp1r32 UTSW 19 10481406 missense probably benign 0.01
R2384:Ppp1r32 UTSW 19 10481282 critical splice donor site probably null
R4362:Ppp1r32 UTSW 19 10475021 missense probably damaging 1.00
R4884:Ppp1r32 UTSW 19 10474501 makesense probably null
R5998:Ppp1r32 UTSW 19 10481352 missense possibly damaging 0.50
R6360:Ppp1r32 UTSW 19 10479481 missense probably damaging 1.00
R6388:Ppp1r32 UTSW 19 10482301 missense probably damaging 1.00
R6625:Ppp1r32 UTSW 19 10481736 missense probably damaging 0.97
R6754:Ppp1r32 UTSW 19 10477089 missense probably damaging 1.00
R7188:Ppp1r32 UTSW 19 10482338 missense probably benign 0.15
R7361:Ppp1r32 UTSW 19 10479579 missense probably damaging 1.00
R7679:Ppp1r32 UTSW 19 10482254 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAATCCAGTGTCCCGATCAG -3'
(R):5'- TCCCATTCTGGACCAGGAGTTG -3'

Sequencing Primer
(F):5'- ATCAGAGCCTCTGGACAGC -3'
(R):5'- TGGTCATTCCACCCAAACTC -3'
Posted On2017-10-10