Incidental Mutation 'R6131:Mmel1'
ID487123
Institutional Source Beutler Lab
Gene Symbol Mmel1
Ensembl Gene ENSMUSG00000058183
Gene Namemembrane metallo-endopeptidase-like 1
SynonymsNep2, Mell1, Nl1, NEPLP gamma, NEPLP beta, NEPLP alpha, SEP
MMRRC Submission 044278-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R6131 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location154869585-154895528 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 154895018 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 728 (H728Y)
Ref Sequence ENSEMBL: ENSMUSP00000131753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030935] [ENSMUST00000079269] [ENSMUST00000080559] [ENSMUST00000105634] [ENSMUST00000105635] [ENSMUST00000132281] [ENSMUST00000163732]
Predicted Effect probably benign
Transcript: ENSMUST00000030935
SMART Domains Protein: ENSMUSP00000030935
Gene: ENSMUSG00000029059

DomainStartEndE-ValueType
Pfam:AhpC-TSA_2 53 166 9.9e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000079269
AA Change: H728Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078252
Gene: ENSMUSG00000058183
AA Change: H728Y

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Peptidase_M13_N 99 498 1.7e-135 PFAM
Pfam:Peptidase_M13 559 767 1.2e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000080559
AA Change: H742Y

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000079399
Gene: ENSMUSG00000058183
AA Change: H742Y

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Peptidase_M13_N 76 512 4.8e-131 PFAM
Pfam:Peptidase_M13 573 779 3.4e-71 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105634
AA Change: H742Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101259
Gene: ENSMUSG00000058183
AA Change: H742Y

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Peptidase_M13_N 76 512 1.4e-105 PFAM
Pfam:Peptidase_M13 573 781 4e-74 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105635
AA Change: H705Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101260
Gene: ENSMUSG00000058183
AA Change: H705Y

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Peptidase_M13_N 76 475 1.6e-135 PFAM
Pfam:Peptidase_M13 536 744 1.2e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123513
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129623
Predicted Effect probably benign
Transcript: ENSMUST00000132281
SMART Domains Protein: ENSMUSP00000116611
Gene: ENSMUSG00000029059

DomainStartEndE-ValueType
Pfam:AhpC-TSA_2 9 114 4.2e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163732
AA Change: H728Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131753
Gene: ENSMUSG00000058183
AA Change: H728Y

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Peptidase_M13_N 99 498 1.7e-135 PFAM
Pfam:Peptidase_M13 559 765 3.3e-71 PFAM
Meta Mutation Damage Score 0.7652 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the neutral endopeptidase (NEP) or membrane metallo-endopeptidase (MME) family. Family members play important roles in pain perception, arterial pressure regulation, phosphate metabolism and homeostasis. This protein is a type II transmembrane protein and is thought to be expressed as a secreted protein. This gene is expressed mainly in testis with weak expression in the brain, kidney, and heart. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display impaired male fertility. Female fertility is not affected. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik A T 15: 84,960,592 W75R probably damaging Het
Abca15 T C 7: 120,340,205 V274A probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ap1m2 T C 9: 21,296,501 Y396C probably damaging Het
Apob T C 12: 8,015,874 S405P probably benign Het
Arhgap26 G T 18: 39,286,585 G533* probably null Het
Atxn2l T C 7: 126,503,165 probably benign Het
Ccdc88c A T 12: 100,941,128 L995H probably damaging Het
Cep192 A G 18: 67,837,997 H1023R possibly damaging Het
Cog5 T A 12: 31,886,221 M589K possibly damaging Het
Col25a1 C A 3: 130,535,465 P337Q probably damaging Het
Cyfip1 T G 7: 55,873,480 V51G possibly damaging Het
Dnah7b A T 1: 46,253,466 I3004F probably damaging Het
Dsg3 A T 18: 20,538,512 D758V probably damaging Het
Dsg3 A G 18: 20,520,477 probably null Het
Eml5 A T 12: 98,861,251 H573Q probably damaging Het
Erp27 T C 6: 136,908,203 D199G probably damaging Het
Flnb A G 14: 7,894,635 Y811C possibly damaging Het
G6pd2 A T 5: 61,809,250 S123C probably benign Het
Gm17677 T A 9: 35,741,544 C27* probably null Het
Gm1818 T A 12: 48,555,536 noncoding transcript Het
Gm29340 C T 2: 116,968,038 noncoding transcript Het
Gm8298 A G 3: 59,868,903 K165R possibly damaging Het
Hcn2 G T 10: 79,733,908 G581W probably damaging Het
Hist1h2bf C A 13: 23,574,136 probably benign Het
Kidins220 T C 12: 24,992,314 probably null Het
Lonp1 T C 17: 56,614,457 E926G probably benign Het
Lrp1 T C 10: 127,560,157 I2415V probably benign Het
Mmp10 A G 9: 7,503,632 probably null Het
Myo16 T A 8: 10,569,877 I1476N probably benign Het
Nectin3 G T 16: 46,395,152 H76N probably damaging Het
Nov A G 15: 54,749,360 D255G probably benign Het
Nphs2 G A 1: 156,325,951 R204Q probably damaging Het
Olfr194 T C 16: 59,119,893 Y59C probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr920 T A 9: 38,756,066 I126N probably damaging Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Psme2b T C 11: 48,945,925 D65G probably damaging Het
Rlf T C 4: 121,154,975 K214E probably damaging Het
Rnasel A T 1: 153,754,460 T241S probably damaging Het
Samd9l C G 6: 3,377,252 G3A probably benign Het
Smg7 A G 1: 152,845,211 probably null Het
Spag16 A G 1: 70,725,083 probably null Het
Spata31d1c T A 13: 65,035,671 D342E probably benign Het
Stab2 A G 10: 86,883,778 probably null Het
Taar7b A T 10: 24,000,717 Y260F probably benign Het
Vcpip1 T C 1: 9,747,292 I289V probably damaging Het
Vmn2r39 A G 7: 9,014,964 V791A probably damaging Het
Vmn2r66 T A 7: 84,995,016 I729F probably damaging Het
Vmn2r-ps130 C T 17: 23,063,655 A103V probably benign Het
Zfp536 T A 7: 37,569,712 D93V probably damaging Het
Other mutations in Mmel1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Mmel1 APN 4 154887832 splice site probably benign
IGL01560:Mmel1 APN 4 154892510 missense probably null 1.00
IGL01734:Mmel1 APN 4 154891951 missense probably benign 0.00
IGL02933:Mmel1 APN 4 154883630 missense probably damaging 1.00
IGL03178:Mmel1 APN 4 154890854 missense possibly damaging 0.75
R1161:Mmel1 UTSW 4 154895214 missense probably damaging 1.00
R1522:Mmel1 UTSW 4 154894986 missense probably damaging 1.00
R1566:Mmel1 UTSW 4 154883653 missense probably damaging 1.00
R1885:Mmel1 UTSW 4 154890876 missense possibly damaging 0.76
R2177:Mmel1 UTSW 4 154894103 missense probably damaging 1.00
R3413:Mmel1 UTSW 4 154889586 missense probably damaging 1.00
R3432:Mmel1 UTSW 4 154885498 splice site probably benign
R3870:Mmel1 UTSW 4 154883638 missense probably benign 0.01
R4197:Mmel1 UTSW 4 154893304 missense probably damaging 1.00
R4822:Mmel1 UTSW 4 154887897 missense probably benign 0.00
R4998:Mmel1 UTSW 4 154885510 missense probably benign 0.00
R5135:Mmel1 UTSW 4 154882324 missense probably benign 0.20
R5225:Mmel1 UTSW 4 154891999 missense probably damaging 0.96
R5821:Mmel1 UTSW 4 154885587 missense possibly damaging 0.82
R6132:Mmel1 UTSW 4 154895018 missense probably damaging 1.00
R6133:Mmel1 UTSW 4 154895018 missense probably damaging 1.00
R6194:Mmel1 UTSW 4 154883216 nonsense probably null
R6223:Mmel1 UTSW 4 154871702 splice site probably null
R6786:Mmel1 UTSW 4 154892428 nonsense probably null
R6921:Mmel1 UTSW 4 154881677 missense probably damaging 0.97
R7272:Mmel1 UTSW 4 154894090 missense probably damaging 1.00
R7373:Mmel1 UTSW 4 154889208 missense not run
R7685:Mmel1 UTSW 4 154871654 start codon destroyed probably null 0.28
R7996:Mmel1 UTSW 4 154892455 missense probably benign 0.03
X0025:Mmel1 UTSW 4 154894685 missense probably benign 0.06
Z1176:Mmel1 UTSW 4 154895208 nonsense probably null
Z1177:Mmel1 UTSW 4 154894074 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GACCTGTTGGCCTCCATATC -3'
(R):5'- ATAGCTCAGCCTTGGCTACCAG -3'

Sequencing Primer
(F):5'- CCTCATCTTACAAACAGCTGTTTAGG -3'
(R):5'- TTGGCTACCAGATGCGACATC -3'
Posted On2017-10-10