Incidental Mutation 'R6131:Zfp536'
ID487128
Institutional Source Beutler Lab
Gene Symbol Zfp536
Ensembl Gene ENSMUSG00000043456
Gene Namezinc finger protein 536
Synonyms
MMRRC Submission 044278-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6131 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location37472135-37773641 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37569712 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 93 (D93V)
Ref Sequence ENSEMBL: ENSMUSP00000135218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056338] [ENSMUST00000175941] [ENSMUST00000176114] [ENSMUST00000176205] [ENSMUST00000176534] [ENSMUST00000176680]
Predicted Effect probably damaging
Transcript: ENSMUST00000056338
AA Change: D93V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058468
Gene: ENSMUSG00000043456
AA Change: D93V

DomainStartEndE-ValueType
ZnF_C2H2 130 152 5.14e-3 SMART
ZnF_C2H2 158 180 8.47e-4 SMART
low complexity region 193 205 N/A INTRINSIC
ZnF_C2H2 274 297 1.03e-2 SMART
ZnF_C2H2 300 323 4.4e-2 SMART
ZnF_C2H2 345 367 3.69e-4 SMART
ZnF_C2H2 373 395 1.26e-2 SMART
ZnF_C2H2 631 653 2.91e-2 SMART
Pfam:zf-C2H2_assoc 657 739 6.6e-43 PFAM
ZnF_C2H2 753 775 6.78e-3 SMART
ZnF_C2H2 781 803 7.26e-3 SMART
low complexity region 928 941 N/A INTRINSIC
ZnF_C2H2 1002 1025 7.29e0 SMART
low complexity region 1198 1212 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000175941
AA Change: D93V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134778
Gene: ENSMUSG00000043456
AA Change: D93V

DomainStartEndE-ValueType
ZnF_C2H2 130 152 5.14e-3 SMART
ZnF_C2H2 158 180 8.47e-4 SMART
low complexity region 193 205 N/A INTRINSIC
ZnF_C2H2 274 297 1.03e-2 SMART
ZnF_C2H2 300 323 4.4e-2 SMART
ZnF_C2H2 345 367 3.69e-4 SMART
ZnF_C2H2 373 395 1.26e-2 SMART
ZnF_C2H2 631 653 2.91e-2 SMART
low complexity region 716 725 N/A INTRINSIC
ZnF_C2H2 753 775 6.78e-3 SMART
ZnF_C2H2 781 803 7.26e-3 SMART
low complexity region 928 941 N/A INTRINSIC
ZnF_C2H2 1002 1025 7.29e0 SMART
low complexity region 1198 1212 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176114
AA Change: D93V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135681
Gene: ENSMUSG00000043456
AA Change: D93V

DomainStartEndE-ValueType
ZnF_C2H2 130 152 5.14e-3 SMART
ZnF_C2H2 158 180 8.47e-4 SMART
low complexity region 193 205 N/A INTRINSIC
ZnF_C2H2 274 297 1.03e-2 SMART
ZnF_C2H2 300 323 4.4e-2 SMART
ZnF_C2H2 345 367 3.69e-4 SMART
ZnF_C2H2 373 395 1.26e-2 SMART
ZnF_C2H2 631 653 2.91e-2 SMART
low complexity region 716 725 N/A INTRINSIC
ZnF_C2H2 753 775 6.78e-3 SMART
ZnF_C2H2 781 803 7.26e-3 SMART
low complexity region 928 941 N/A INTRINSIC
ZnF_C2H2 1002 1025 7.29e0 SMART
low complexity region 1198 1212 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176205
AA Change: D93V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135068
Gene: ENSMUSG00000043456
AA Change: D93V

DomainStartEndE-ValueType
ZnF_C2H2 130 152 5.14e-3 SMART
ZnF_C2H2 158 180 8.47e-4 SMART
low complexity region 193 205 N/A INTRINSIC
ZnF_C2H2 274 297 1.03e-2 SMART
ZnF_C2H2 300 323 4.4e-2 SMART
ZnF_C2H2 345 367 3.69e-4 SMART
ZnF_C2H2 373 395 1.26e-2 SMART
ZnF_C2H2 631 653 2.91e-2 SMART
low complexity region 716 725 N/A INTRINSIC
ZnF_C2H2 753 775 6.78e-3 SMART
ZnF_C2H2 781 803 7.26e-3 SMART
low complexity region 928 941 N/A INTRINSIC
ZnF_C2H2 1002 1025 7.29e0 SMART
low complexity region 1198 1212 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176534
AA Change: D93V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000176680
AA Change: D93V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135218
Gene: ENSMUSG00000043456
AA Change: D93V

DomainStartEndE-ValueType
ZnF_C2H2 130 152 5.14e-3 SMART
Meta Mutation Damage Score 0.3059 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a highly conserved zinc finger protein. The encoded protein is most abundant in brain, where it negatively regulates neuronal differentiation. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik A T 15: 84,960,592 W75R probably damaging Het
Abca15 T C 7: 120,340,205 V274A probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ap1m2 T C 9: 21,296,501 Y396C probably damaging Het
Apob T C 12: 8,015,874 S405P probably benign Het
Arhgap26 G T 18: 39,286,585 G533* probably null Het
Atxn2l T C 7: 126,503,165 probably benign Het
Ccdc88c A T 12: 100,941,128 L995H probably damaging Het
Cep192 A G 18: 67,837,997 H1023R possibly damaging Het
Cog5 T A 12: 31,886,221 M589K possibly damaging Het
Col25a1 C A 3: 130,535,465 P337Q probably damaging Het
Cyfip1 T G 7: 55,873,480 V51G possibly damaging Het
Dnah7b A T 1: 46,253,466 I3004F probably damaging Het
Dsg3 A T 18: 20,538,512 D758V probably damaging Het
Dsg3 A G 18: 20,520,477 probably null Het
Eml5 A T 12: 98,861,251 H573Q probably damaging Het
Erp27 T C 6: 136,908,203 D199G probably damaging Het
Flnb A G 14: 7,894,635 Y811C possibly damaging Het
G6pd2 A T 5: 61,809,250 S123C probably benign Het
Gm17677 T A 9: 35,741,544 C27* probably null Het
Gm1818 T A 12: 48,555,536 noncoding transcript Het
Gm29340 C T 2: 116,968,038 noncoding transcript Het
Gm8298 A G 3: 59,868,903 K165R possibly damaging Het
Hcn2 G T 10: 79,733,908 G581W probably damaging Het
Hist1h2bf C A 13: 23,574,136 probably benign Het
Kidins220 T C 12: 24,992,314 probably null Het
Lonp1 T C 17: 56,614,457 E926G probably benign Het
Lrp1 T C 10: 127,560,157 I2415V probably benign Het
Mmel1 C T 4: 154,895,018 H728Y probably damaging Het
Mmp10 A G 9: 7,503,632 probably null Het
Myo16 T A 8: 10,569,877 I1476N probably benign Het
Nectin3 G T 16: 46,395,152 H76N probably damaging Het
Nov A G 15: 54,749,360 D255G probably benign Het
Nphs2 G A 1: 156,325,951 R204Q probably damaging Het
Olfr194 T C 16: 59,119,893 Y59C probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr920 T A 9: 38,756,066 I126N probably damaging Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Psme2b T C 11: 48,945,925 D65G probably damaging Het
Rlf T C 4: 121,154,975 K214E probably damaging Het
Rnasel A T 1: 153,754,460 T241S probably damaging Het
Samd9l C G 6: 3,377,252 G3A probably benign Het
Smg7 A G 1: 152,845,211 probably null Het
Spag16 A G 1: 70,725,083 probably null Het
Spata31d1c T A 13: 65,035,671 D342E probably benign Het
Stab2 A G 10: 86,883,778 probably null Het
Taar7b A T 10: 24,000,717 Y260F probably benign Het
Vcpip1 T C 1: 9,747,292 I289V probably damaging Het
Vmn2r39 A G 7: 9,014,964 V791A probably damaging Het
Vmn2r66 T A 7: 84,995,016 I729F probably damaging Het
Vmn2r-ps130 C T 17: 23,063,655 A103V probably benign Het
Other mutations in Zfp536
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01075:Zfp536 APN 7 37567890 missense probably damaging 0.99
IGL02729:Zfp536 APN 7 37493718 missense probably damaging 1.00
PIT4453001:Zfp536 UTSW 7 37479757 missense probably benign 0.08
R0211:Zfp536 UTSW 7 37568449 missense probably damaging 1.00
R0369:Zfp536 UTSW 7 37567948 missense probably damaging 1.00
R0504:Zfp536 UTSW 7 37568818 missense probably damaging 1.00
R0554:Zfp536 UTSW 7 37480819 missense probably damaging 1.00
R1171:Zfp536 UTSW 7 37569634 missense probably damaging 1.00
R1462:Zfp536 UTSW 7 37479310 missense probably damaging 1.00
R1462:Zfp536 UTSW 7 37479310 missense probably damaging 1.00
R1699:Zfp536 UTSW 7 37569454 missense probably damaging 1.00
R1817:Zfp536 UTSW 7 37568617 missense probably damaging 1.00
R1918:Zfp536 UTSW 7 37480199 missense probably damaging 1.00
R2252:Zfp536 UTSW 7 37479389 missense probably benign 0.30
R2288:Zfp536 UTSW 7 37480348 missense probably damaging 0.98
R2509:Zfp536 UTSW 7 37567978 missense possibly damaging 0.87
R3967:Zfp536 UTSW 7 37473830 makesense probably null
R4039:Zfp536 UTSW 7 37569550 missense probably damaging 1.00
R4600:Zfp536 UTSW 7 37568493 missense probably damaging 1.00
R4706:Zfp536 UTSW 7 37569466 missense probably damaging 1.00
R4771:Zfp536 UTSW 7 37568884 missense probably damaging 1.00
R4808:Zfp536 UTSW 7 37479305 missense probably damaging 1.00
R4945:Zfp536 UTSW 7 37569736 missense probably damaging 1.00
R5196:Zfp536 UTSW 7 37480760 missense probably damaging 1.00
R5506:Zfp536 UTSW 7 37568792 missense probably damaging 1.00
R5816:Zfp536 UTSW 7 37480628 missense probably damaging 1.00
R6114:Zfp536 UTSW 7 37479736 missense probably damaging 0.99
R6156:Zfp536 UTSW 7 37473856 missense unknown
R6257:Zfp536 UTSW 7 37480405 missense probably damaging 1.00
R6864:Zfp536 UTSW 7 37568515 missense probably damaging 1.00
R6975:Zfp536 UTSW 7 37568527 missense probably damaging 1.00
R6976:Zfp536 UTSW 7 37480403 missense probably damaging 1.00
R7176:Zfp536 UTSW 7 37480851 critical splice acceptor site probably null
R7247:Zfp536 UTSW 7 37569206 missense probably benign 0.04
R7325:Zfp536 UTSW 7 37479860 missense probably benign
R7650:Zfp536 UTSW 7 37569692 missense probably damaging 1.00
R7782:Zfp536 UTSW 7 37568701 missense probably damaging 1.00
R7827:Zfp536 UTSW 7 37569688 missense probably damaging 1.00
R8013:Zfp536 UTSW 7 37569610 missense probably damaging 1.00
R8209:Zfp536 UTSW 7 37568655 missense probably benign 0.00
R8504:Zfp536 UTSW 7 37480067 missense probably benign
X0066:Zfp536 UTSW 7 37569781 missense possibly damaging 0.93
Z1176:Zfp536 UTSW 7 37493812 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GCAGTAGGGGCACTTGAATG -3'
(R):5'- ATGCCATGAGCCAGAAGTTG -3'

Sequencing Primer
(F):5'- GGGCACTTGAATGGCTTCTCAC -3'
(R):5'- TGAGCCAGAAGTTGCACCAGATC -3'
Posted On2017-10-10