Mutagenetix > Incidental Mutations

Incidental Mutation 'R6131:Vmn2r66'

487130

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r66

Ensembl Gene

ENSMUSG00000094950

Gene Name

vomeronasal 2, receptor 66

Synonyms

F830104D24Rik

MMRRC Submission

044278-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.201) question?

Stock #

R6131 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

84994645-85012020 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 84995016 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 729 (I729F)

Ref Sequence

ENSEMBL: ENSMUSP00000122645 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000124773]

Predicted Effect

probably damaging
Transcript: ENSMUST00000124773
AA Change: I729F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000122645
Gene: ENSMUSG00000094950
AA Change: I729F

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	77	463	5e-31	PFAM
Pfam:NCD3G	507	559	6e-21	PFAM
Pfam:7tm_3	589	827	3.8e-52	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.8%

Validation Efficiency

96% (50/52)

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5031439G07Rik	A	T	15: 84,960,592	W75R	probably damaging	Het
Abca15	T	C	7: 120,340,205	V274A	probably benign	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Ap1m2	T	C	9: 21,296,501	Y396C	probably damaging	Het
Apob	T	C	12: 8,015,874	S405P	probably benign	Het
Arhgap26	G	T	18: 39,286,585	G533*	probably null	Het
Atxn2l	T	C	7: 126,503,165		probably benign	Het
Ccdc88c	A	T	12: 100,941,128	L995H	probably damaging	Het
Cep192	A	G	18: 67,837,997	H1023R	possibly damaging	Het
Cog5	T	A	12: 31,886,221	M589K	possibly damaging	Het
Col25a1	C	A	3: 130,535,465	P337Q	probably damaging	Het
Cyfip1	T	G	7: 55,873,480	V51G	possibly damaging	Het
Dnah7b	A	T	1: 46,253,466	I3004F	probably damaging	Het
Dsg3	A	G	18: 20,520,477		probably null	Het
Dsg3	A	T	18: 20,538,512	D758V	probably damaging	Het
Eml5	A	T	12: 98,861,251	H573Q	probably damaging	Het
Erp27	T	C	6: 136,908,203	D199G	probably damaging	Het
Flnb	A	G	14: 7,894,635	Y811C	possibly damaging	Het
G6pd2	A	T	5: 61,809,250	S123C	probably benign	Het
Gm17677	T	A	9: 35,741,544	C27*	probably null	Het
Gm1818	T	A	12: 48,555,536		noncoding transcript	Het
Gm29340	C	T	2: 116,968,038		noncoding transcript	Het
Gm8298	A	G	3: 59,868,903	K165R	possibly damaging	Het
Hcn2	G	T	10: 79,733,908	G581W	probably damaging	Het
Hist1h2bf	C	A	13: 23,574,136		probably benign	Het
Kidins220	T	C	12: 24,992,314		probably null	Het
Lonp1	T	C	17: 56,614,457	E926G	probably benign	Het
Lrp1	T	C	10: 127,560,157	I2415V	probably benign	Het
Mmel1	C	T	4: 154,895,018	H728Y	probably damaging	Het
Mmp10	A	G	9: 7,503,632		probably null	Het
Myo16	T	A	8: 10,569,877	I1476N	probably benign	Het
Nectin3	G	T	16: 46,395,152	H76N	probably damaging	Het
Nov	A	G	15: 54,749,360	D255G	probably benign	Het
Nphs2	G	A	1: 156,325,951	R204Q	probably damaging	Het
Olfr194	T	C	16: 59,119,893	Y59C	probably damaging	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
Olfr920	T	A	9: 38,756,066	I126N	probably damaging	Het
Otx1	A	T	11: 21,999,406	L24H	probably damaging	Het
Psme2b	T	C	11: 48,945,925	D65G	probably damaging	Het
Rlf	T	C	4: 121,154,975	K214E	probably damaging	Het
Rnasel	A	T	1: 153,754,460	T241S	probably damaging	Het
Samd9l	C	G	6: 3,377,252	G3A	probably benign	Het
Smg7	A	G	1: 152,845,211		probably null	Het
Spag16	A	G	1: 70,725,083		probably null	Het
Spata31d1c	T	A	13: 65,035,671	D342E	probably benign	Het
Stab2	A	G	10: 86,883,778		probably null	Het
Taar7b	A	T	10: 24,000,717	Y260F	probably benign	Het
Vcpip1	T	C	1: 9,747,292	I289V	probably damaging	Het
Vmn2r39	A	G	7: 9,014,964	V791A	probably damaging	Het
Vmn2r-ps130	C	T	17: 23,063,655	A103V	probably benign	Het
Zfp536	T	A	7: 37,569,712	D93V	probably damaging	Het

Other mutations in Vmn2r66

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00321:Vmn2r66	APN	7	85007091	missense	probably benign
IGL01562:Vmn2r66	APN	7	85007287	missense	probably benign	0.03
IGL01689:Vmn2r66	APN	7	85007825	missense	probably damaging	1.00
IGL02237:Vmn2r66	APN	7	84994700	missense	probably benign
IGL02415:Vmn2r66	APN	7	85006812	missense	probably damaging	0.97
IGL02439:Vmn2r66	APN	7	85005247	splice site	probably benign
IGL02545:Vmn2r66	APN	7	85006590	missense	possibly damaging	0.50
IGL02708:Vmn2r66	APN	7	85006588	missense	probably benign	0.00
IGL02794:Vmn2r66	APN	7	84995415	missense	probably benign	0.00
IGL02885:Vmn2r66	APN	7	84995515	missense	probably benign	0.00
IGL02975:Vmn2r66	APN	7	85006974	missense	probably damaging	0.98
IGL03027:Vmn2r66	APN	7	84995569	splice site	probably benign
IGL03081:Vmn2r66	APN	7	85007930	missense	probably benign
PIT4131001:Vmn2r66	UTSW	7	84995093	missense	probably damaging	1.00
R0098:Vmn2r66	UTSW	7	85005757	missense	probably damaging	1.00
R0504:Vmn2r66	UTSW	7	85006815	missense	probably damaging	0.99
R0557:Vmn2r66	UTSW	7	84994764	missense	probably damaging	1.00
R0617:Vmn2r66	UTSW	7	84995276	missense	probably benign	0.02
R0883:Vmn2r66	UTSW	7	85007862	missense	probably benign
R1159:Vmn2r66	UTSW	7	84995405	missense	probably benign	0.44
R1168:Vmn2r66	UTSW	7	85006854	missense	possibly damaging	0.46
R1172:Vmn2r66	UTSW	7	85005591	missense	probably benign	0.04
R1175:Vmn2r66	UTSW	7	85005591	missense	probably benign	0.04
R1538:Vmn2r66	UTSW	7	84994958	missense	possibly damaging	0.84
R1658:Vmn2r66	UTSW	7	85007747	missense	probably benign	0.07
R1937:Vmn2r66	UTSW	7	84995136	missense	probably damaging	0.99
R1989:Vmn2r66	UTSW	7	85011993	missense	probably benign	0.01
R2698:Vmn2r66	UTSW	7	84995399	missense	probably damaging	1.00
R2890:Vmn2r66	UTSW	7	85011819	splice site	probably null
R3686:Vmn2r66	UTSW	7	84995189	missense	probably damaging	0.96
R4152:Vmn2r66	UTSW	7	85005592	missense	probably benign	0.08
R4500:Vmn2r66	UTSW	7	85007954	missense	probably damaging	1.00
R4618:Vmn2r66	UTSW	7	84995088	missense	possibly damaging	0.62
R4656:Vmn2r66	UTSW	7	85011996	missense	possibly damaging	0.87
R4668:Vmn2r66	UTSW	7	84994697	missense	probably damaging	1.00
R4942:Vmn2r66	UTSW	7	85007772	missense	probably damaging	1.00
R5163:Vmn2r66	UTSW	7	85006809	missense	probably benign	0.01
R5223:Vmn2r66	UTSW	7	85007885	missense	probably benign
R5377:Vmn2r66	UTSW	7	85006818	missense	probably damaging	0.99
R5512:Vmn2r66	UTSW	7	85007941	missense	probably damaging	1.00
R5611:Vmn2r66	UTSW	7	85005743	nonsense	probably null
R5749:Vmn2r66	UTSW	7	85006771	nonsense	probably null
R6183:Vmn2r66	UTSW	7	84995558	missense	possibly damaging	0.81
R6509:Vmn2r66	UTSW	7	85006846	missense	probably benign	0.12
R6930:Vmn2r66	UTSW	7	85012008	missense	possibly damaging	0.80
R6992:Vmn2r66	UTSW	7	85005228	missense	possibly damaging	0.90
R7015:Vmn2r66	UTSW	7	84995558	missense	possibly damaging	0.81
R7302:Vmn2r66	UTSW	7	85005215	missense	probably benign	0.00
R7516:Vmn2r66	UTSW	7	85011968	missense	possibly damaging	0.51
R7763:Vmn2r66	UTSW	7	85005701	missense	probably benign	0.01
R7814:Vmn2r66	UTSW	7	85007264	missense	probably benign	0.02
R8077:Vmn2r66	UTSW	7	85006885	missense	probably benign
R8307:Vmn2r66	UTSW	7	85007062	missense	probably benign
R8315:Vmn2r66	UTSW	7	84994724	missense	possibly damaging	0.90
R8490:Vmn2r66	UTSW	7	85005586	critical splice donor site	probably null
R8511:Vmn2r66	UTSW	7	85006818	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGATCCAGACACTGCAGAAC -3'
(R):5'- GCAGACCACATTTGCCATTG -3'

Sequencing Primer
(F):5'- CACCAGCATGCTGAATGTCAAGAG -3'
(R):5'- TACTGTAGTATTGGCATTCAAGGC -3'

Posted On

2017-10-10