Incidental Mutation 'R6131:Gm17677'
ID487135
Institutional Source Beutler Lab
Gene Symbol Gm17677
Ensembl Gene ENSMUSG00000091174
Gene Namepredicted gene, 17677
Synonyms
MMRRC Submission 044278-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R6131 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location35741049-35742252 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 35741544 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 27 (C27*)
Ref Sequence ENSEMBL: ENSMUSP00000132657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166746]
Predicted Effect probably null
Transcript: ENSMUST00000166746
AA Change: C27*
SMART Domains Protein: ENSMUSP00000132657
Gene: ENSMUSG00000091174
AA Change: C27*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 96% (50/52)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik A T 15: 84,960,592 W75R probably damaging Het
Abca15 T C 7: 120,340,205 V274A probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ap1m2 T C 9: 21,296,501 Y396C probably damaging Het
Apob T C 12: 8,015,874 S405P probably benign Het
Arhgap26 G T 18: 39,286,585 G533* probably null Het
Atxn2l T C 7: 126,503,165 probably benign Het
Ccdc88c A T 12: 100,941,128 L995H probably damaging Het
Cep192 A G 18: 67,837,997 H1023R possibly damaging Het
Cog5 T A 12: 31,886,221 M589K possibly damaging Het
Col25a1 C A 3: 130,535,465 P337Q probably damaging Het
Cyfip1 T G 7: 55,873,480 V51G possibly damaging Het
Dnah7b A T 1: 46,253,466 I3004F probably damaging Het
Dsg3 A T 18: 20,538,512 D758V probably damaging Het
Dsg3 A G 18: 20,520,477 probably null Het
Eml5 A T 12: 98,861,251 H573Q probably damaging Het
Erp27 T C 6: 136,908,203 D199G probably damaging Het
Flnb A G 14: 7,894,635 Y811C possibly damaging Het
G6pd2 A T 5: 61,809,250 S123C probably benign Het
Gm1818 T A 12: 48,555,536 noncoding transcript Het
Gm29340 C T 2: 116,968,038 noncoding transcript Het
Gm8298 A G 3: 59,868,903 K165R possibly damaging Het
Hcn2 G T 10: 79,733,908 G581W probably damaging Het
Hist1h2bf C A 13: 23,574,136 probably benign Het
Kidins220 T C 12: 24,992,314 probably null Het
Lonp1 T C 17: 56,614,457 E926G probably benign Het
Lrp1 T C 10: 127,560,157 I2415V probably benign Het
Mmel1 C T 4: 154,895,018 H728Y probably damaging Het
Mmp10 A G 9: 7,503,632 probably null Het
Myo16 T A 8: 10,569,877 I1476N probably benign Het
Nectin3 G T 16: 46,395,152 H76N probably damaging Het
Nov A G 15: 54,749,360 D255G probably benign Het
Nphs2 G A 1: 156,325,951 R204Q probably damaging Het
Olfr194 T C 16: 59,119,893 Y59C probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr920 T A 9: 38,756,066 I126N probably damaging Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Psme2b T C 11: 48,945,925 D65G probably damaging Het
Rlf T C 4: 121,154,975 K214E probably damaging Het
Rnasel A T 1: 153,754,460 T241S probably damaging Het
Samd9l C G 6: 3,377,252 G3A probably benign Het
Smg7 A G 1: 152,845,211 probably null Het
Spag16 A G 1: 70,725,083 probably null Het
Spata31d1c T A 13: 65,035,671 D342E probably benign Het
Stab2 A G 10: 86,883,778 probably null Het
Taar7b A T 10: 24,000,717 Y260F probably benign Het
Vcpip1 T C 1: 9,747,292 I289V probably damaging Het
Vmn2r39 A G 7: 9,014,964 V791A probably damaging Het
Vmn2r66 T A 7: 84,995,016 I729F probably damaging Het
Vmn2r-ps130 C T 17: 23,063,655 A103V probably benign Het
Zfp536 T A 7: 37,569,712 D93V probably damaging Het
Other mutations in Gm17677
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02593:Gm17677 APN 9 35742142 missense possibly damaging 0.92
IGL02612:Gm17677 APN 9 35742164 missense possibly damaging 0.92
IGL02648:Gm17677 APN 9 35741109 missense probably benign 0.14
IGL02698:Gm17677 APN 9 35741120 splice site probably benign
R4240:Gm17677 UTSW 9 35742153 nonsense probably null
R4983:Gm17677 UTSW 9 35742169 missense probably benign 0.12
R5161:Gm17677 UTSW 9 35741588 nonsense probably null
R5545:Gm17677 UTSW 9 35741644 missense probably benign 0.10
R5980:Gm17677 UTSW 9 35741615 missense probably damaging 0.99
R6147:Gm17677 UTSW 9 35742110 missense possibly damaging 0.94
R6147:Gm17677 UTSW 9 35742232 missense possibly damaging 0.66
X0066:Gm17677 UTSW 9 35742170 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TCCTGGGCATCTTGATGTCC -3'
(R):5'- ACATGAGTCCAGATCTAGTGCTC -3'

Sequencing Primer
(F):5'- GGGCATCTTGATGTCCAATAAC -3'
(R):5'- GAGTCCAGATCTAGTGCTCTTATTC -3'
Posted On2017-10-10