Incidental Mutation 'R6131:Olfr920'
ID487137
Institutional Source Beutler Lab
Gene Symbol Olfr920
Ensembl Gene ENSMUSG00000061039
Gene Nameolfactory receptor 920
SynonymsMOR165-6, GA_x6K02T2PVTD-32458442-32459374
MMRRC Submission 044278-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R6131 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location38752299-38760117 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38756066 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 126 (I126N)
Ref Sequence ENSEMBL: ENSMUSP00000074300 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074740]
Predicted Effect probably damaging
Transcript: ENSMUST00000074740
AA Change: I126N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074300
Gene: ENSMUSG00000061039
AA Change: I126N

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.2e-47 PFAM
Pfam:7tm_1 41 290 3.6e-22 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik A T 15: 84,960,592 W75R probably damaging Het
Abca15 T C 7: 120,340,205 V274A probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ap1m2 T C 9: 21,296,501 Y396C probably damaging Het
Apob T C 12: 8,015,874 S405P probably benign Het
Arhgap26 G T 18: 39,286,585 G533* probably null Het
Atxn2l T C 7: 126,503,165 probably benign Het
Ccdc88c A T 12: 100,941,128 L995H probably damaging Het
Cep192 A G 18: 67,837,997 H1023R possibly damaging Het
Cog5 T A 12: 31,886,221 M589K possibly damaging Het
Col25a1 C A 3: 130,535,465 P337Q probably damaging Het
Cyfip1 T G 7: 55,873,480 V51G possibly damaging Het
Dnah7b A T 1: 46,253,466 I3004F probably damaging Het
Dsg3 A T 18: 20,538,512 D758V probably damaging Het
Dsg3 A G 18: 20,520,477 probably null Het
Eml5 A T 12: 98,861,251 H573Q probably damaging Het
Erp27 T C 6: 136,908,203 D199G probably damaging Het
Flnb A G 14: 7,894,635 Y811C possibly damaging Het
G6pd2 A T 5: 61,809,250 S123C probably benign Het
Gm17677 T A 9: 35,741,544 C27* probably null Het
Gm1818 T A 12: 48,555,536 noncoding transcript Het
Gm29340 C T 2: 116,968,038 noncoding transcript Het
Gm8298 A G 3: 59,868,903 K165R possibly damaging Het
Hcn2 G T 10: 79,733,908 G581W probably damaging Het
Hist1h2bf C A 13: 23,574,136 probably benign Het
Kidins220 T C 12: 24,992,314 probably null Het
Lonp1 T C 17: 56,614,457 E926G probably benign Het
Lrp1 T C 10: 127,560,157 I2415V probably benign Het
Mmel1 C T 4: 154,895,018 H728Y probably damaging Het
Mmp10 A G 9: 7,503,632 probably null Het
Myo16 T A 8: 10,569,877 I1476N probably benign Het
Nectin3 G T 16: 46,395,152 H76N probably damaging Het
Nov A G 15: 54,749,360 D255G probably benign Het
Nphs2 G A 1: 156,325,951 R204Q probably damaging Het
Olfr194 T C 16: 59,119,893 Y59C probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Psme2b T C 11: 48,945,925 D65G probably damaging Het
Rlf T C 4: 121,154,975 K214E probably damaging Het
Rnasel A T 1: 153,754,460 T241S probably damaging Het
Samd9l C G 6: 3,377,252 G3A probably benign Het
Smg7 A G 1: 152,845,211 probably null Het
Spag16 A G 1: 70,725,083 probably null Het
Spata31d1c T A 13: 65,035,671 D342E probably benign Het
Stab2 A G 10: 86,883,778 probably null Het
Taar7b A T 10: 24,000,717 Y260F probably benign Het
Vcpip1 T C 1: 9,747,292 I289V probably damaging Het
Vmn2r39 A G 7: 9,014,964 V791A probably damaging Het
Vmn2r66 T A 7: 84,995,016 I729F probably damaging Het
Vmn2r-ps130 C T 17: 23,063,655 A103V probably benign Het
Zfp536 T A 7: 37,569,712 D93V probably damaging Het
Other mutations in Olfr920
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01686:Olfr920 APN 9 38756254 missense probably damaging 1.00
IGL01728:Olfr920 APN 9 38756095 missense possibly damaging 0.63
IGL01867:Olfr920 APN 9 38755898 missense probably damaging 1.00
IGL02271:Olfr920 APN 9 38756488 missense probably benign
IGL03078:Olfr920 APN 9 38756245 nonsense probably null
R0166:Olfr920 UTSW 9 38756188 missense probably benign
R0446:Olfr920 UTSW 9 38755818 missense probably damaging 1.00
R0453:Olfr920 UTSW 9 38756129 missense probably damaging 0.99
R0556:Olfr920 UTSW 9 38755745 missense possibly damaging 0.88
R1585:Olfr920 UTSW 9 38756420 missense probably damaging 1.00
R2847:Olfr920 UTSW 9 38756036 missense possibly damaging 0.89
R4676:Olfr920 UTSW 9 38755659 start gained probably benign
R4825:Olfr920 UTSW 9 38756407 missense probably damaging 1.00
R5026:Olfr920 UTSW 9 38755745 missense probably benign 0.01
R5144:Olfr920 UTSW 9 38756393 missense possibly damaging 0.90
R5573:Olfr920 UTSW 9 38755704 missense probably damaging 1.00
R5872:Olfr920 UTSW 9 38756116 missense probably benign 0.06
R6729:Olfr920 UTSW 9 38755828 missense probably benign 0.00
R7731:Olfr920 UTSW 9 38756246 missense possibly damaging 0.90
R7800:Olfr920 UTSW 9 38756618 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AAGTACCCCTGTTCCTGGTC -3'
(R):5'- CATTGACATAGGTGCTGGTGC -3'

Sequencing Primer
(F):5'- AACTGCATTGGGGAATTTGAC -3'
(R):5'- TGCAGGAGAGTTGCAGC -3'
Posted On2017-10-10