Mutagenetix > Incidental Mutations

Incidental Mutation 'R6131:Olfr920'

487137

Institutional Source

Beutler Lab

Gene Symbol

Olfr920

Ensembl Gene

ENSMUSG00000061039

Gene Name

olfactory receptor 920

Synonyms

MOR165-6, GA_x6K02T2PVTD-32458442-32459374

MMRRC Submission

044278-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.051) question?

Stock #

R6131 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

38752299-38760117 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 38756066 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 126 (I126N)

Ref Sequence

ENSEMBL: ENSMUSP00000074300 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074740]

Predicted Effect

probably damaging
Transcript: ENSMUST00000074740
AA Change: I126N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000074300
Gene: ENSMUSG00000061039
AA Change: I126N

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	308	3.2e-47	PFAM
Pfam:7tm_1	41	290	3.6e-22	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.8%

Validation Efficiency

96% (50/52)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5031439G07Rik	A	T	15: 84,960,592	W75R	probably damaging	Het
Abca15	T	C	7: 120,340,205	V274A	probably benign	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Ap1m2	T	C	9: 21,296,501	Y396C	probably damaging	Het
Apob	T	C	12: 8,015,874	S405P	probably benign	Het
Arhgap26	G	T	18: 39,286,585	G533*	probably null	Het
Atxn2l	T	C	7: 126,503,165		probably benign	Het
Ccdc88c	A	T	12: 100,941,128	L995H	probably damaging	Het
Cep192	A	G	18: 67,837,997	H1023R	possibly damaging	Het
Cog5	T	A	12: 31,886,221	M589K	possibly damaging	Het
Col25a1	C	A	3: 130,535,465	P337Q	probably damaging	Het
Cyfip1	T	G	7: 55,873,480	V51G	possibly damaging	Het
Dnah7b	A	T	1: 46,253,466	I3004F	probably damaging	Het
Dsg3	A	T	18: 20,538,512	D758V	probably damaging	Het
Dsg3	A	G	18: 20,520,477		probably null	Het
Eml5	A	T	12: 98,861,251	H573Q	probably damaging	Het
Erp27	T	C	6: 136,908,203	D199G	probably damaging	Het
Flnb	A	G	14: 7,894,635	Y811C	possibly damaging	Het
G6pd2	A	T	5: 61,809,250	S123C	probably benign	Het
Gm17677	T	A	9: 35,741,544	C27*	probably null	Het
Gm1818	T	A	12: 48,555,536		noncoding transcript	Het
Gm29340	C	T	2: 116,968,038		noncoding transcript	Het
Gm8298	A	G	3: 59,868,903	K165R	possibly damaging	Het
Hcn2	G	T	10: 79,733,908	G581W	probably damaging	Het
Hist1h2bf	C	A	13: 23,574,136		probably benign	Het
Kidins220	T	C	12: 24,992,314		probably null	Het
Lonp1	T	C	17: 56,614,457	E926G	probably benign	Het
Lrp1	T	C	10: 127,560,157	I2415V	probably benign	Het
Mmel1	C	T	4: 154,895,018	H728Y	probably damaging	Het
Mmp10	A	G	9: 7,503,632		probably null	Het
Myo16	T	A	8: 10,569,877	I1476N	probably benign	Het
Nectin3	G	T	16: 46,395,152	H76N	probably damaging	Het
Nov	A	G	15: 54,749,360	D255G	probably benign	Het
Nphs2	G	A	1: 156,325,951	R204Q	probably damaging	Het
Olfr194	T	C	16: 59,119,893	Y59C	probably damaging	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
Otx1	A	T	11: 21,999,406	L24H	probably damaging	Het
Psme2b	T	C	11: 48,945,925	D65G	probably damaging	Het
Rlf	T	C	4: 121,154,975	K214E	probably damaging	Het
Rnasel	A	T	1: 153,754,460	T241S	probably damaging	Het
Samd9l	C	G	6: 3,377,252	G3A	probably benign	Het
Smg7	A	G	1: 152,845,211		probably null	Het
Spag16	A	G	1: 70,725,083		probably null	Het
Spata31d1c	T	A	13: 65,035,671	D342E	probably benign	Het
Stab2	A	G	10: 86,883,778		probably null	Het
Taar7b	A	T	10: 24,000,717	Y260F	probably benign	Het
Vcpip1	T	C	1: 9,747,292	I289V	probably damaging	Het
Vmn2r39	A	G	7: 9,014,964	V791A	probably damaging	Het
Vmn2r66	T	A	7: 84,995,016	I729F	probably damaging	Het
Vmn2r-ps130	C	T	17: 23,063,655	A103V	probably benign	Het
Zfp536	T	A	7: 37,569,712	D93V	probably damaging	Het

Other mutations in Olfr920

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01686:Olfr920	APN	9	38756254	missense	probably damaging	1.00
IGL01728:Olfr920	APN	9	38756095	missense	possibly damaging	0.63
IGL01867:Olfr920	APN	9	38755898	missense	probably damaging	1.00
IGL02271:Olfr920	APN	9	38756488	missense	probably benign
IGL03078:Olfr920	APN	9	38756245	nonsense	probably null
R0166:Olfr920	UTSW	9	38756188	missense	probably benign
R0446:Olfr920	UTSW	9	38755818	missense	probably damaging	1.00
R0453:Olfr920	UTSW	9	38756129	missense	probably damaging	0.99
R0556:Olfr920	UTSW	9	38755745	missense	possibly damaging	0.88
R1585:Olfr920	UTSW	9	38756420	missense	probably damaging	1.00
R2847:Olfr920	UTSW	9	38756036	missense	possibly damaging	0.89
R4676:Olfr920	UTSW	9	38755659	start gained	probably benign
R4825:Olfr920	UTSW	9	38756407	missense	probably damaging	1.00
R5026:Olfr920	UTSW	9	38755745	missense	probably benign	0.01
R5144:Olfr920	UTSW	9	38756393	missense	possibly damaging	0.90
R5573:Olfr920	UTSW	9	38755704	missense	probably damaging	1.00
R5872:Olfr920	UTSW	9	38756116	missense	probably benign	0.06
R6729:Olfr920	UTSW	9	38755828	missense	probably benign	0.00
R7731:Olfr920	UTSW	9	38756246	missense	possibly damaging	0.90
R7800:Olfr920	UTSW	9	38756618	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- AAGTACCCCTGTTCCTGGTC -3'
(R):5'- CATTGACATAGGTGCTGGTGC -3'

Sequencing Primer
(F):5'- AACTGCATTGGGGAATTTGAC -3'
(R):5'- TGCAGGAGAGTTGCAGC -3'

Posted On

2017-10-10