Incidental Mutation 'R6131:Psme2b'
ID487142
Institutional Source Beutler Lab
Gene Symbol Psme2b
Ensembl Gene ENSMUSG00000078153
Gene Nameprotease (prosome, macropain) activator subunit 2B
SynonymsPsme2-like, PA28b2, Psme2b, Psme2b-ps
MMRRC Submission 044278-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R6131 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location48945354-48946190 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48945925 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 65 (D65G)
Ref Sequence ENSEMBL: ENSMUSP00000100564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059930] [ENSMUST00000097494] [ENSMUST00000104958]
Predicted Effect probably benign
Transcript: ENSMUST00000059930
SMART Domains Protein: ENSMUSP00000054351
Gene: ENSMUSG00000048852

DomainStartEndE-ValueType
Pfam:IIGP 27 389 8.4e-123 PFAM
Pfam:MMR_HSR1 63 190 2.2e-9 PFAM
low complexity region 421 432 N/A INTRINSIC
Pfam:IIGP 438 811 3.4e-152 PFAM
Pfam:MMR_HSR1 474 632 1.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097494
SMART Domains Protein: ENSMUSP00000095102
Gene: ENSMUSG00000069893

DomainStartEndE-ValueType
Pfam:IIGP 36 398 2e-125 PFAM
Pfam:DLIC 52 107 3.2e-5 PFAM
Pfam:MMR_HSR1 72 235 2e-11 PFAM
low complexity region 430 444 N/A INTRINSIC
Pfam:IIGP 447 820 1.9e-153 PFAM
Pfam:MMR_HSR1 483 611 3.6e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000104958
AA Change: D65G

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000100564
Gene: ENSMUSG00000078153
AA Change: D65G

DomainStartEndE-ValueType
Pfam:PA28_alpha 11 71 1.2e-26 PFAM
Pfam:PA28_beta 93 237 5.3e-58 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: This gene may encode proteasome activator complex subunit 2 protein (PMID: 10222192). This gene, located on chromosome 11, lacks a structured promoter and is intronless. It has also been described as a pseudogene (PMID: 9914329), however, it has an intact coding region and transcripts can be placed at this location unambiguously. An interferon-inducible gene located on chromosome 14, near the gene that encodes proteasome activator complex subunit 1 protein, is considered the functional gene. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik A T 15: 84,960,592 W75R probably damaging Het
Abca15 T C 7: 120,340,205 V274A probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ap1m2 T C 9: 21,296,501 Y396C probably damaging Het
Apob T C 12: 8,015,874 S405P probably benign Het
Arhgap26 G T 18: 39,286,585 G533* probably null Het
Atxn2l T C 7: 126,503,165 probably benign Het
Ccdc88c A T 12: 100,941,128 L995H probably damaging Het
Cep192 A G 18: 67,837,997 H1023R possibly damaging Het
Cog5 T A 12: 31,886,221 M589K possibly damaging Het
Col25a1 C A 3: 130,535,465 P337Q probably damaging Het
Cyfip1 T G 7: 55,873,480 V51G possibly damaging Het
Dnah7b A T 1: 46,253,466 I3004F probably damaging Het
Dsg3 A T 18: 20,538,512 D758V probably damaging Het
Dsg3 A G 18: 20,520,477 probably null Het
Eml5 A T 12: 98,861,251 H573Q probably damaging Het
Erp27 T C 6: 136,908,203 D199G probably damaging Het
Flnb A G 14: 7,894,635 Y811C possibly damaging Het
G6pd2 A T 5: 61,809,250 S123C probably benign Het
Gm17677 T A 9: 35,741,544 C27* probably null Het
Gm1818 T A 12: 48,555,536 noncoding transcript Het
Gm29340 C T 2: 116,968,038 noncoding transcript Het
Gm8298 A G 3: 59,868,903 K165R possibly damaging Het
Hcn2 G T 10: 79,733,908 G581W probably damaging Het
Hist1h2bf C A 13: 23,574,136 probably benign Het
Kidins220 T C 12: 24,992,314 probably null Het
Lonp1 T C 17: 56,614,457 E926G probably benign Het
Lrp1 T C 10: 127,560,157 I2415V probably benign Het
Mmel1 C T 4: 154,895,018 H728Y probably damaging Het
Mmp10 A G 9: 7,503,632 probably null Het
Myo16 T A 8: 10,569,877 I1476N probably benign Het
Nectin3 G T 16: 46,395,152 H76N probably damaging Het
Nov A G 15: 54,749,360 D255G probably benign Het
Nphs2 G A 1: 156,325,951 R204Q probably damaging Het
Olfr194 T C 16: 59,119,893 Y59C probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr920 T A 9: 38,756,066 I126N probably damaging Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Rlf T C 4: 121,154,975 K214E probably damaging Het
Rnasel A T 1: 153,754,460 T241S probably damaging Het
Samd9l C G 6: 3,377,252 G3A probably benign Het
Smg7 A G 1: 152,845,211 probably null Het
Spag16 A G 1: 70,725,083 probably null Het
Spata31d1c T A 13: 65,035,671 D342E probably benign Het
Stab2 A G 10: 86,883,778 probably null Het
Taar7b A T 10: 24,000,717 Y260F probably benign Het
Vcpip1 T C 1: 9,747,292 I289V probably damaging Het
Vmn2r39 A G 7: 9,014,964 V791A probably damaging Het
Vmn2r66 T A 7: 84,995,016 I729F probably damaging Het
Vmn2r-ps130 C T 17: 23,063,655 A103V probably benign Het
Zfp536 T A 7: 37,569,712 D93V probably damaging Het
Other mutations in Psme2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02490:Psme2b APN 11 48946119 utr 5 prime probably benign
IGL03309:Psme2b APN 11 48945799 splice site probably null
R0087:Psme2b UTSW 11 48945717 missense possibly damaging 0.95
R0523:Psme2b UTSW 11 48945782 missense probably damaging 0.97
R1467:Psme2b UTSW 11 48945640 missense probably damaging 1.00
R1467:Psme2b UTSW 11 48945640 missense probably damaging 1.00
R1502:Psme2b UTSW 11 48945749 missense probably damaging 1.00
R1540:Psme2b UTSW 11 48945382 splice site probably null
R1793:Psme2b UTSW 11 48945534 missense probably damaging 1.00
R1967:Psme2b UTSW 11 48946069 missense probably damaging 0.99
R2426:Psme2b UTSW 11 48946063 missense probably benign 0.20
R4667:Psme2b UTSW 11 48945666 missense probably benign 0.00
R5011:Psme2b UTSW 11 48945827 missense probably benign 0.00
R5013:Psme2b UTSW 11 48945827 missense probably benign 0.00
R6860:Psme2b UTSW 11 48945480 nonsense probably null
R7079:Psme2b UTSW 11 48945616 missense probably damaging 1.00
R7794:Psme2b UTSW 11 48945856 missense probably benign
R7888:Psme2b UTSW 11 48945575 missense possibly damaging 0.72
RF020:Psme2b UTSW 11 48945570 missense probably damaging 0.97
X0025:Psme2b UTSW 11 48945886 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAATTGCCACCCCAAAATCATTTC -3'
(R):5'- CTTGAGTGGAGAAGCCCGAA -3'

Sequencing Primer
(F):5'- TGGATCCACGTGATTACCAG -3'
(R):5'- CCCGAAAACAGGTGGATGTCTTC -3'
Posted On2017-10-10