Mutagenetix > Incidental Mutations

Incidental Mutation 'R6131:Gm1818'

487145

Institutional Source

Beutler Lab

Gene Symbol

Gm1818

Ensembl Gene

ENSMUSG00000091277

Gene Name

predicted gene 1818

Synonyms

LOC217536

MMRRC Submission

044278-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.916) question?

Stock #

R6131 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

48555059-48559896 bp(-) (GRCm38)

Type of Mutation

exon

DNA Base Change (assembly)

T to A at 48555536 bp

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s):

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000169406

SMART Domains

Protein: ENSMUSP00000131939
Gene: ENSMUSG00000091277

Domain	Start	End	E-Value	Type
low complexity region	1	22	N/A	INTRINSIC
Pfam:RrnaAD	78	377	4.3e-23	PFAM

Meta Mutation Damage Score

0.0869

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.8%

Validation Efficiency

96% (50/52)

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5031439G07Rik	A	T	15: 84,960,592	W75R	probably damaging	Het
Abca15	T	C	7: 120,340,205	V274A	probably benign	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Ap1m2	T	C	9: 21,296,501	Y396C	probably damaging	Het
Apob	T	C	12: 8,015,874	S405P	probably benign	Het
Arhgap26	G	T	18: 39,286,585	G533*	probably null	Het
Atxn2l	T	C	7: 126,503,165		probably benign	Het
Ccdc88c	A	T	12: 100,941,128	L995H	probably damaging	Het
Cep192	A	G	18: 67,837,997	H1023R	possibly damaging	Het
Cog5	T	A	12: 31,886,221	M589K	possibly damaging	Het
Col25a1	C	A	3: 130,535,465	P337Q	probably damaging	Het
Cyfip1	T	G	7: 55,873,480	V51G	possibly damaging	Het
Dnah7b	A	T	1: 46,253,466	I3004F	probably damaging	Het
Dsg3	A	T	18: 20,538,512	D758V	probably damaging	Het
Dsg3	A	G	18: 20,520,477		probably null	Het
Eml5	A	T	12: 98,861,251	H573Q	probably damaging	Het
Erp27	T	C	6: 136,908,203	D199G	probably damaging	Het
Flnb	A	G	14: 7,894,635	Y811C	possibly damaging	Het
G6pd2	A	T	5: 61,809,250	S123C	probably benign	Het
Gm17677	T	A	9: 35,741,544	C27*	probably null	Het
Gm29340	C	T	2: 116,968,038		noncoding transcript	Het
Gm8298	A	G	3: 59,868,903	K165R	possibly damaging	Het
Hcn2	G	T	10: 79,733,908	G581W	probably damaging	Het
Hist1h2bf	C	A	13: 23,574,136		probably benign	Het
Kidins220	T	C	12: 24,992,314		probably null	Het
Lonp1	T	C	17: 56,614,457	E926G	probably benign	Het
Lrp1	T	C	10: 127,560,157	I2415V	probably benign	Het
Mmel1	C	T	4: 154,895,018	H728Y	probably damaging	Het
Mmp10	A	G	9: 7,503,632		probably null	Het
Myo16	T	A	8: 10,569,877	I1476N	probably benign	Het
Nectin3	G	T	16: 46,395,152	H76N	probably damaging	Het
Nov	A	G	15: 54,749,360	D255G	probably benign	Het
Nphs2	G	A	1: 156,325,951	R204Q	probably damaging	Het
Olfr194	T	C	16: 59,119,893	Y59C	probably damaging	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
Olfr920	T	A	9: 38,756,066	I126N	probably damaging	Het
Otx1	A	T	11: 21,999,406	L24H	probably damaging	Het
Psme2b	T	C	11: 48,945,925	D65G	probably damaging	Het
Rlf	T	C	4: 121,154,975	K214E	probably damaging	Het
Rnasel	A	T	1: 153,754,460	T241S	probably damaging	Het
Samd9l	C	G	6: 3,377,252	G3A	probably benign	Het
Smg7	A	G	1: 152,845,211		probably null	Het
Spag16	A	G	1: 70,725,083		probably null	Het
Spata31d1c	T	A	13: 65,035,671	D342E	probably benign	Het
Stab2	A	G	10: 86,883,778		probably null	Het
Taar7b	A	T	10: 24,000,717	Y260F	probably benign	Het
Vcpip1	T	C	1: 9,747,292	I289V	probably damaging	Het
Vmn2r39	A	G	7: 9,014,964	V791A	probably damaging	Het
Vmn2r66	T	A	7: 84,995,016	I729F	probably damaging	Het
Vmn2r-ps130	C	T	17: 23,063,655	A103V	probably benign	Het
Zfp536	T	A	7: 37,569,712	D93V	probably damaging	Het

Other mutations in Gm1818

Allele	Source	Chr	Coord	Type	Predicted Effect
IGL01456:Gm1818	APN	12	48555800	exon	noncoding transcript
IGL01472:Gm1818	APN	12	48556289	exon	noncoding transcript
IGL01634:Gm1818	APN	12	48556209	exon	noncoding transcript
IGL01874:Gm1818	APN	12	48556190	exon	noncoding transcript
IGL02287:Gm1818	APN	12	48555722	exon	noncoding transcript
IGL02805:Gm1818	APN	12	48555735	exon	noncoding transcript
R1174:Gm1818	UTSW	12	48556199	exon	noncoding transcript
R1175:Gm1818	UTSW	12	48556199	exon	noncoding transcript
R1636:Gm1818	UTSW	12	48555767	exon	noncoding transcript
R4797:Gm1818	UTSW	12	48555610	exon	noncoding transcript
R4828:Gm1818	UTSW	12	48555626	exon	noncoding transcript
R4937:Gm1818	UTSW	12	48559824	exon	noncoding transcript
R5022:Gm1818	UTSW	12	48555535	exon	noncoding transcript
R5023:Gm1818	UTSW	12	48555535	exon	noncoding transcript
R5952:Gm1818	UTSW	12	48555936	exon	noncoding transcript
R6057:Gm1818	UTSW	12	48555563	exon	noncoding transcript
Z1088:Gm1818	UTSW	12	48556124	exon	noncoding transcript

Predicted Primers

PCR Primer
(F):5'- TCCGGGCAGTAGTCATAGATCC -3'
(R):5'- AGTTCCTGCACATGGAACCTTG -3'

Sequencing Primer
(F):5'- GGCAGTAGTCATAGATCCACTTAAAG -3'
(R):5'- ACATGGAACCTTGGTCGTC -3'

Posted On

2017-10-10