Mutagenetix > Incidental Mutation

Incidental Mutation 'R6131:Eml5'

487146

Institutional Source

Beutler Lab

Gene Symbol

Eml5

Ensembl Gene

ENSMUSG00000051166

Gene Name

echinoderm microtubule associated protein like 5

Synonyms

C130068M19Rik

MMRRC Submission

044278-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.237) question?

Stock #

R6131 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

98786805-98901484 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 98861251 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 573 (H573Q)

Ref Sequence

ENSEMBL: ENSMUSP00000152709 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065716] [ENSMUST00000223282]

AlphaFold

Q8BQM8

Predicted Effect

probably damaging
Transcript: ENSMUST00000065716
AA Change: H534Q

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000065643
Gene: ENSMUSG00000051166
AA Change: H534Q

Domain	Start	End	E-Value	Type
Pfam:HELP	1	49	3.3e-21	PFAM
WD40	50	91	6.42e-1	SMART
WD40	94	136	1.08e-4	SMART
WD40	139	178	1.27e-1	SMART
WD40	184	224	2.75e1	SMART
WD40	225	263	2.65e-4	SMART
Blast:WD40	265	312	2e-22	BLAST
WD40	313	353	4.69e-5	SMART
WD40	356	394	2.2e2	SMART
WD40	397	436	8.59e-1	SMART
WD40	444	479	6.6e1	SMART
WD40	505	546	2.74e2	SMART
WD40	552	592	4.8e-2	SMART
low complexity region	609	632	N/A	INTRINSIC
Pfam:HELP	656	715	1.4e-20	PFAM
WD40	716	757	1.18e-1	SMART
WD40	760	802	2.84e-4	SMART
WD40	805	844	1.91e1	SMART
WD40	853	891	2.64e2	SMART
WD40	892	929	3.45e-3	SMART
WD40	985	1026	4.55e-3	SMART
WD40	1029	1068	6.39e0	SMART
WD40	1071	1111	5.15e-2	SMART
WD40	1180	1221	1.9e2	SMART
WD40	1227	1267	1.38e0	SMART
low complexity region	1280	1297	N/A	INTRINSIC
Pfam:HELP	1335	1410	2.4e-16	PFAM
Blast:WD40	1412	1462	8e-28	BLAST
WD40	1465	1507	1.56e-1	SMART
WD40	1510	1549	2.06e0	SMART
WD40	1558	1597	8.22e1	SMART
WD40	1599	1644	4.26e1	SMART
WD40	1690	1730	2.19e-5	SMART
WD40	1774	1813	5.97e-1	SMART
WD40	1884	1925	2.39e0	SMART
WD40	1931	1971	2.88e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000223282
AA Change: H573Q

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

Meta Mutation Damage Score

0.0822

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.8%

Validation Efficiency

96% (50/52)

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5031439G07Rik	A	T	15: 84,960,592	W75R	probably damaging	Het
Abca15	T	C	7: 120,340,205	V274A	probably benign	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Ap1m2	T	C	9: 21,296,501	Y396C	probably damaging	Het
Apob	T	C	12: 8,015,874	S405P	probably benign	Het
Arhgap26	G	T	18: 39,286,585	G533*	probably null	Het
Atxn2l	T	C	7: 126,503,165		probably benign	Het
Ccdc88c	A	T	12: 100,941,128	L995H	probably damaging	Het
Cep192	A	G	18: 67,837,997	H1023R	possibly damaging	Het
Cog5	T	A	12: 31,886,221	M589K	possibly damaging	Het
Col25a1	C	A	3: 130,535,465	P337Q	probably damaging	Het
Cyfip1	T	G	7: 55,873,480	V51G	possibly damaging	Het
Dnah7b	A	T	1: 46,253,466	I3004F	probably damaging	Het
Dsg3	A	T	18: 20,538,512	D758V	probably damaging	Het
Dsg3	A	G	18: 20,520,477		probably null	Het
Erp27	T	C	6: 136,908,203	D199G	probably damaging	Het
Flnb	A	G	14: 7,894,635	Y811C	possibly damaging	Het
G6pd2	A	T	5: 61,809,250	S123C	probably benign	Het
Gm17677	T	A	9: 35,741,544	C27*	probably null	Het
Gm1818	T	A	12: 48,555,536		noncoding transcript	Het
Gm29340	C	T	2: 116,968,038		noncoding transcript	Het
Gm8298	A	G	3: 59,868,903	K165R	possibly damaging	Het
Hcn2	G	T	10: 79,733,908	G581W	probably damaging	Het
Hist1h2bf	C	A	13: 23,574,136		probably benign	Het
Kidins220	T	C	12: 24,992,314		probably null	Het
Lonp1	T	C	17: 56,614,457	E926G	probably benign	Het
Lrp1	T	C	10: 127,560,157	I2415V	probably benign	Het
Mmel1	C	T	4: 154,895,018	H728Y	probably damaging	Het
Mmp10	A	G	9: 7,503,632		probably null	Het
Myo16	T	A	8: 10,569,877	I1476N	probably benign	Het
Nectin3	G	T	16: 46,395,152	H76N	probably damaging	Het
Nov	A	G	15: 54,749,360	D255G	probably benign	Het
Nphs2	G	A	1: 156,325,951	R204Q	probably damaging	Het
Olfr194	T	C	16: 59,119,893	Y59C	probably damaging	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
Olfr920	T	A	9: 38,756,066	I126N	probably damaging	Het
Otx1	A	T	11: 21,999,406	L24H	probably damaging	Het
Psme2b	T	C	11: 48,945,925	D65G	probably damaging	Het
Rlf	T	C	4: 121,154,975	K214E	probably damaging	Het
Rnasel	A	T	1: 153,754,460	T241S	probably damaging	Het
Samd9l	C	G	6: 3,377,252	G3A	probably benign	Het
Smg7	A	G	1: 152,845,211		probably null	Het
Spag16	A	G	1: 70,725,083		probably null	Het
Spata31d1c	T	A	13: 65,035,671	D342E	probably benign	Het
Stab2	A	G	10: 86,883,778		probably null	Het
Taar7b	A	T	10: 24,000,717	Y260F	probably benign	Het
Vcpip1	T	C	1: 9,747,292	I289V	probably damaging	Het
Vmn2r39	A	G	7: 9,014,964	V791A	probably damaging	Het
Vmn2r66	T	A	7: 84,995,016	I729F	probably damaging	Het
Vmn2r-ps130	C	T	17: 23,063,655	A103V	probably benign	Het
Zfp536	T	A	7: 37,569,712	D93V	probably damaging	Het

Other mutations in Eml5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Eml5	APN	12	98873209	splice site	probably benign
IGL00473:Eml5	APN	12	98805492	splice site	probably benign
IGL01120:Eml5	APN	12	98844019	missense	probably benign
IGL01308:Eml5	APN	12	98802313	missense	probably damaging	1.00
IGL01790:Eml5	APN	12	98798932	missense	probably damaging	1.00
IGL01973:Eml5	APN	12	98863280	missense	probably benign
IGL02182:Eml5	APN	12	98802322	missense	probably damaging	1.00
IGL02201:Eml5	APN	12	98794424	splice site	probably benign
IGL02375:Eml5	APN	12	98844087	missense	probably damaging	1.00
IGL02397:Eml5	APN	12	98790674	missense	probably benign	0.07
IGL02480:Eml5	APN	12	98876243	missense	probably damaging	1.00
IGL02801:Eml5	APN	12	98817845	missense	possibly damaging	0.88
IGL02876:Eml5	APN	12	98858841	missense	probably damaging	1.00
IGL03104:Eml5	APN	12	98861245	nonsense	probably null
IGL03158:Eml5	APN	12	98827514	splice site	probably benign
IGL03286:Eml5	APN	12	98860503	missense	probably damaging	1.00
IGL03380:Eml5	APN	12	98874647	splice site	probably benign
BB010:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
BB020:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
R0573:Eml5	UTSW	12	98824772	splice site	probably null
R0624:Eml5	UTSW	12	98865479	missense	probably damaging	1.00
R0993:Eml5	UTSW	12	98861183	missense	probably benign	0.25
R1073:Eml5	UTSW	12	98830973	missense	probably damaging	1.00
R1183:Eml5	UTSW	12	98792046	missense	probably benign	0.31
R1352:Eml5	UTSW	12	98831003	splice site	probably benign
R1469:Eml5	UTSW	12	98858823	missense	probably benign
R1469:Eml5	UTSW	12	98858823	missense	probably benign
R1503:Eml5	UTSW	12	98831174	missense	probably damaging	0.99
R1538:Eml5	UTSW	12	98794276	missense	probably damaging	0.99
R1689:Eml5	UTSW	12	98830935	missense	probably damaging	1.00
R1773:Eml5	UTSW	12	98798839	missense	probably damaging	1.00
R1775:Eml5	UTSW	12	98852704	splice site	probably null
R1791:Eml5	UTSW	12	98887056	missense	probably benign	0.31
R1856:Eml5	UTSW	12	98810584	missense	probably damaging	1.00
R1919:Eml5	UTSW	12	98798839	missense	probably damaging	1.00
R1957:Eml5	UTSW	12	98859961	missense	probably damaging	1.00
R1962:Eml5	UTSW	12	98876311	missense	probably damaging	0.99
R2033:Eml5	UTSW	12	98791386	missense	possibly damaging	0.71
R2035:Eml5	UTSW	12	98794266	missense	probably benign	0.33
R2073:Eml5	UTSW	12	98802446	missense	probably damaging	0.99
R2143:Eml5	UTSW	12	98810605	missense	probably damaging	1.00
R2144:Eml5	UTSW	12	98810605	missense	probably damaging	1.00
R2158:Eml5	UTSW	12	98843946	splice site	probably benign
R2164:Eml5	UTSW	12	98887097	missense	probably damaging	0.99
R2175:Eml5	UTSW	12	98876223	nonsense	probably null
R2200:Eml5	UTSW	12	98825417	missense	probably damaging	1.00
R2234:Eml5	UTSW	12	98841581	missense	probably damaging	1.00
R2504:Eml5	UTSW	12	98844105	missense	possibly damaging	0.71
R2871:Eml5	UTSW	12	98865401	missense	probably damaging	1.00
R2871:Eml5	UTSW	12	98865401	missense	probably damaging	1.00
R2958:Eml5	UTSW	12	98876178	missense	possibly damaging	0.74
R3013:Eml5	UTSW	12	98880808	splice site	probably null
R3118:Eml5	UTSW	12	98865494	missense	probably damaging	0.97
R3735:Eml5	UTSW	12	98855989	missense	possibly damaging	0.78
R3856:Eml5	UTSW	12	98816024	missense	probably damaging	1.00
R3900:Eml5	UTSW	12	98825523	missense	probably damaging	1.00
R3973:Eml5	UTSW	12	98802465	splice site	probably benign
R3976:Eml5	UTSW	12	98802465	splice site	probably benign
R4105:Eml5	UTSW	12	98841548	splice site	probably null
R4107:Eml5	UTSW	12	98841548	splice site	probably null
R4108:Eml5	UTSW	12	98841548	splice site	probably null
R4109:Eml5	UTSW	12	98841548	splice site	probably null
R4258:Eml5	UTSW	12	98865434	missense	probably benign	0.01
R4381:Eml5	UTSW	12	98815955	missense	possibly damaging	0.93
R4590:Eml5	UTSW	12	98837341	missense	possibly damaging	0.91
R4737:Eml5	UTSW	12	98798852	missense	probably damaging	1.00
R4775:Eml5	UTSW	12	98802307	missense	probably benign	0.05
R4850:Eml5	UTSW	12	98790619	missense	probably damaging	1.00
R5007:Eml5	UTSW	12	98830965	missense	probably damaging	1.00
R5092:Eml5	UTSW	12	98792616	missense	probably damaging	1.00
R5123:Eml5	UTSW	12	98874512	missense	probably damaging	1.00
R5124:Eml5	UTSW	12	98792042	missense	probably damaging	1.00
R5273:Eml5	UTSW	12	98790688	missense	probably damaging	1.00
R5369:Eml5	UTSW	12	98858783	missense	probably damaging	1.00
R5430:Eml5	UTSW	12	98794158	missense	probably damaging	1.00
R5748:Eml5	UTSW	12	98825555	missense	probably damaging	0.99
R5769:Eml5	UTSW	12	98790619	missense	probably damaging	1.00
R5832:Eml5	UTSW	12	98876188	missense	probably benign
R6113:Eml5	UTSW	12	98824674	nonsense	probably null
R6175:Eml5	UTSW	12	98794456	missense	possibly damaging	0.69
R6184:Eml5	UTSW	12	98863129	missense	possibly damaging	0.53
R6357:Eml5	UTSW	12	98870884	missense	probably damaging	0.98
R6375:Eml5	UTSW	12	98798868
R6528:Eml5	UTSW	12	98824637	missense	probably benign	0.18
R6657:Eml5	UTSW	12	98791405	missense	probably damaging	0.98
R6717:Eml5	UTSW	12	98827506	missense	probably damaging	1.00
R6751:Eml5	UTSW	12	98865400	missense	probably damaging	1.00
R6833:Eml5	UTSW	12	98887024	missense	probably damaging	1.00
R6834:Eml5	UTSW	12	98887024	missense	probably damaging	1.00
R6972:Eml5	UTSW	12	98876180	missense	probably benign	0.00
R7091:Eml5	UTSW	12	98802474	missense	probably benign	0.16
R7353:Eml5	UTSW	12	98825424	missense
R7644:Eml5	UTSW	12	98855944	missense	probably benign	0.05
R7694:Eml5	UTSW	12	98792563	missense	probably damaging	0.99
R7842:Eml5	UTSW	12	98794135	missense	probably damaging	1.00
R7933:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
R8111:Eml5	UTSW	12	98792514	critical splice donor site	probably null
R8198:Eml5	UTSW	12	98858886	nonsense	probably null
R8482:Eml5	UTSW	12	98876301	missense	probably damaging	1.00
R8732:Eml5	UTSW	12	98815959	missense	probably damaging	0.99
R8956:Eml5	UTSW	12	98852693	missense	possibly damaging	0.69
R8975:Eml5	UTSW	12	98810570	missense	probably damaging	0.99
R9131:Eml5	UTSW	12	98858840	missense	probably damaging	1.00
R9258:Eml5	UTSW	12	98844117	missense	possibly damaging	0.77
R9261:Eml5	UTSW	12	98856028	missense	probably damaging	0.99
R9276:Eml5	UTSW	12	98798801	missense	probably damaging	0.99
R9301:Eml5	UTSW	12	98882033	nonsense	probably null
R9368:Eml5	UTSW	12	98796578	missense	probably benign	0.31
R9392:Eml5	UTSW	12	98900940	missense	probably damaging	1.00
R9393:Eml5	UTSW	12	98876174	missense	probably benign	0.35
R9449:Eml5	UTSW	12	98861295	missense	probably damaging	1.00
R9570:Eml5	UTSW	12	98815984	missense	probably benign	0.15
T0722:Eml5	UTSW	12	98841582	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- CCGTGGTACCTGACTTTAAAGATATAC -3'
(R):5'- TCCCATCTGGTCATACTCAGTG -3'

Sequencing Primer
(F):5'- CAGGAAATTTCTGCTAGTAAGAAGC -3'
(R):5'- CCATCTGGTCATACTCAGTGTTGTG -3'

Posted On

2017-10-10