Mutagenetix > Incidental Mutations

Incidental Mutation 'R6131:Spata31d1c'

487149

Institutional Source

Beutler Lab

Gene Symbol

Spata31d1c

Ensembl Gene

ENSMUSG00000074849

Gene Name

spermatogenesis associated 31 subfamily D, member 1C

Synonyms

4932441B19Rik, Fam75d1c

MMRRC Submission

044278-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6131 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

65033058-65038004 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 65035671 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 342 (D342E)

Ref Sequence

ENSEMBL: ENSMUSP00000097024 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099427]

Predicted Effect

probably benign
Transcript: ENSMUST00000099427
AA Change: D342E

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000097024
Gene: ENSMUSG00000074849
AA Change: D342E

Domain	Start	End	E-Value	Type
transmembrane domain	22	44	N/A	INTRINSIC
Pfam:DUF4599	63	148	2.4e-31	PFAM
low complexity region	178	190	N/A	INTRINSIC
low complexity region	196	213	N/A	INTRINSIC
low complexity region	218	233	N/A	INTRINSIC
low complexity region	237	251	N/A	INTRINSIC
Pfam:FAM75	380	742	1.4e-120	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.8%

Validation Efficiency

96% (50/52)

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5031439G07Rik	A	T	15: 84,960,592	W75R	probably damaging	Het
Abca15	T	C	7: 120,340,205	V274A	probably benign	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Ap1m2	T	C	9: 21,296,501	Y396C	probably damaging	Het
Apob	T	C	12: 8,015,874	S405P	probably benign	Het
Arhgap26	G	T	18: 39,286,585	G533*	probably null	Het
Atxn2l	T	C	7: 126,503,165		probably benign	Het
Ccdc88c	A	T	12: 100,941,128	L995H	probably damaging	Het
Cep192	A	G	18: 67,837,997	H1023R	possibly damaging	Het
Cog5	T	A	12: 31,886,221	M589K	possibly damaging	Het
Col25a1	C	A	3: 130,535,465	P337Q	probably damaging	Het
Cyfip1	T	G	7: 55,873,480	V51G	possibly damaging	Het
Dnah7b	A	T	1: 46,253,466	I3004F	probably damaging	Het
Dsg3	A	T	18: 20,538,512	D758V	probably damaging	Het
Dsg3	A	G	18: 20,520,477		probably null	Het
Eml5	A	T	12: 98,861,251	H573Q	probably damaging	Het
Erp27	T	C	6: 136,908,203	D199G	probably damaging	Het
Flnb	A	G	14: 7,894,635	Y811C	possibly damaging	Het
G6pd2	A	T	5: 61,809,250	S123C	probably benign	Het
Gm17677	T	A	9: 35,741,544	C27*	probably null	Het
Gm1818	T	A	12: 48,555,536		noncoding transcript	Het
Gm29340	C	T	2: 116,968,038		noncoding transcript	Het
Gm8298	A	G	3: 59,868,903	K165R	possibly damaging	Het
Hcn2	G	T	10: 79,733,908	G581W	probably damaging	Het
Hist1h2bf	C	A	13: 23,574,136		probably benign	Het
Kidins220	T	C	12: 24,992,314		probably null	Het
Lonp1	T	C	17: 56,614,457	E926G	probably benign	Het
Lrp1	T	C	10: 127,560,157	I2415V	probably benign	Het
Mmel1	C	T	4: 154,895,018	H728Y	probably damaging	Het
Mmp10	A	G	9: 7,503,632		probably null	Het
Myo16	T	A	8: 10,569,877	I1476N	probably benign	Het
Nectin3	G	T	16: 46,395,152	H76N	probably damaging	Het
Nov	A	G	15: 54,749,360	D255G	probably benign	Het
Nphs2	G	A	1: 156,325,951	R204Q	probably damaging	Het
Olfr194	T	C	16: 59,119,893	Y59C	probably damaging	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
Olfr920	T	A	9: 38,756,066	I126N	probably damaging	Het
Otx1	A	T	11: 21,999,406	L24H	probably damaging	Het
Psme2b	T	C	11: 48,945,925	D65G	probably damaging	Het
Rlf	T	C	4: 121,154,975	K214E	probably damaging	Het
Rnasel	A	T	1: 153,754,460	T241S	probably damaging	Het
Samd9l	C	G	6: 3,377,252	G3A	probably benign	Het
Smg7	A	G	1: 152,845,211		probably null	Het
Spag16	A	G	1: 70,725,083		probably null	Het
Stab2	A	G	10: 86,883,778		probably null	Het
Taar7b	A	T	10: 24,000,717	Y260F	probably benign	Het
Vcpip1	T	C	1: 9,747,292	I289V	probably damaging	Het
Vmn2r39	A	G	7: 9,014,964	V791A	probably damaging	Het
Vmn2r66	T	A	7: 84,995,016	I729F	probably damaging	Het
Vmn2r-ps130	C	T	17: 23,063,655	A103V	probably benign	Het
Zfp536	T	A	7: 37,569,712	D93V	probably damaging	Het

Other mutations in Spata31d1c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01639:Spata31d1c	APN	13	65036089	missense	probably damaging	1.00
IGL02830:Spata31d1c	APN	13	65035366	missense	probably benign	0.25
IGL02947:Spata31d1c	APN	13	65034945	nonsense	probably null
IGL03133:Spata31d1c	APN	13	65034985	missense	probably benign	0.18
IGL03176:Spata31d1c	APN	13	65037011	missense	probably benign	0.01
IGL03183:Spata31d1c	APN	13	65035195	missense	possibly damaging	0.86
IGL03206:Spata31d1c	APN	13	65035593	missense	probably benign	0.41
PIT4382001:Spata31d1c	UTSW	13	65036171	missense	probably benign	0.01
R0054:Spata31d1c	UTSW	13	65033062	start gained	probably benign
R0959:Spata31d1c	UTSW	13	65036315	missense	probably damaging	1.00
R1232:Spata31d1c	UTSW	13	65036614	missense	probably benign
R1347:Spata31d1c	UTSW	13	65035388	missense	probably benign	0.00
R1381:Spata31d1c	UTSW	13	65036554	missense	probably benign	0.08
R1573:Spata31d1c	UTSW	13	65035069	missense	possibly damaging	0.92
R1582:Spata31d1c	UTSW	13	65033224	missense	probably benign
R1639:Spata31d1c	UTSW	13	65036039	missense	probably benign
R1716:Spata31d1c	UTSW	13	65033216	missense	possibly damaging	0.86
R1781:Spata31d1c	UTSW	13	65036171	missense	probably benign	0.01
R1907:Spata31d1c	UTSW	13	65035876	missense	probably benign	0.03
R2012:Spata31d1c	UTSW	13	65035227	missense	possibly damaging	0.91
R2152:Spata31d1c	UTSW	13	65033965	critical splice donor site	probably null
R2211:Spata31d1c	UTSW	13	65035939	missense	probably benign	0.04
R2571:Spata31d1c	UTSW	13	65036384	missense	probably damaging	1.00
R2908:Spata31d1c	UTSW	13	65033191	missense	possibly damaging	0.63
R3978:Spata31d1c	UTSW	13	65035160	missense	possibly damaging	0.61
R3979:Spata31d1c	UTSW	13	65035160	missense	possibly damaging	0.61
R3980:Spata31d1c	UTSW	13	65035160	missense	possibly damaging	0.61
R3981:Spata31d1c	UTSW	13	65035111	missense	possibly damaging	0.68
R4014:Spata31d1c	UTSW	13	65035399	missense	probably damaging	0.99
R4255:Spata31d1c	UTSW	13	65035688	nonsense	probably null
R4255:Spata31d1c	UTSW	13	65035717	missense	probably benign	0.04
R4592:Spata31d1c	UTSW	13	65036060	missense	probably damaging	0.99
R4597:Spata31d1c	UTSW	13	65035613	nonsense	probably null
R4624:Spata31d1c	UTSW	13	65036597	missense	probably benign
R4641:Spata31d1c	UTSW	13	65035048	missense	probably benign	0.01
R4863:Spata31d1c	UTSW	13	65035790	nonsense	probably null
R5084:Spata31d1c	UTSW	13	65035130	missense	probably damaging	0.98
R5152:Spata31d1c	UTSW	13	65035595	missense	probably damaging	1.00
R5230:Spata31d1c	UTSW	13	65035434	missense	probably benign	0.41
R5267:Spata31d1c	UTSW	13	65035904	missense	probably damaging	0.98
R5615:Spata31d1c	UTSW	13	65035264	missense	possibly damaging	0.61
R5755:Spata31d1c	UTSW	13	65036527	missense	probably benign	0.12
R5935:Spata31d1c	UTSW	13	65037080	missense	possibly damaging	0.68
R6017:Spata31d1c	UTSW	13	65035079	missense	possibly damaging	0.91
R6359:Spata31d1c	UTSW	13	65035592	missense	possibly damaging	0.63
R6723:Spata31d1c	UTSW	13	65035944	missense	probably benign	0.01
R7028:Spata31d1c	UTSW	13	65036063	missense	probably damaging	0.98
R7336:Spata31d1c	UTSW	13	65036128	missense	probably damaging	0.99
R7426:Spata31d1c	UTSW	13	65035361	missense	probably benign
R7552:Spata31d1c	UTSW	13	65036123	missense	probably damaging	0.98
R7605:Spata31d1c	UTSW	13	65035840	missense	probably benign	0.00
R7666:Spata31d1c	UTSW	13	65036000	missense	probably benign	0.01
R8403:Spata31d1c	UTSW	13	65036230	missense	probably benign	0.42
R8445:Spata31d1c	UTSW	13	65033177	missense	probably damaging	0.98
R8513:Spata31d1c	UTSW	13	65033177	missense	probably damaging	0.98
R8515:Spata31d1c	UTSW	13	65033177	missense	probably damaging	0.98
R8523:Spata31d1c	UTSW	13	65033177	missense	probably damaging	0.98
X0022:Spata31d1c	UTSW	13	65036927	missense	probably benign	0.35

Predicted Primers

PCR Primer
(F):5'- CAATGTCAGAATTTATCCAGCAGC -3'
(R):5'- TCACTGTGTAGAGAAGGGAGTC -3'

Sequencing Primer
(F):5'- AGCAGACTGATACAGGCAAC -3'
(R):5'- CCAGAAGGACTGGGTATT -3'

Posted On

2017-10-10