Incidental Mutation 'R6131:Nectin3'
ID487153
Institutional Source Beutler Lab
Gene Symbol Nectin3
Ensembl Gene ENSMUSG00000022656
Gene Namenectin cell adhesion molecule 3
Synonyms3000002N23Rik, 2610301B19Rik, nectin-3, 4921513D19Rik, Pvrl3
MMRRC Submission 044278-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R6131 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location46387706-46498525 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 46395152 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 76 (H76N)
Ref Sequence ENSEMBL: ENSMUSP00000113301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023335] [ENSMUST00000119941] [ENSMUST00000121245] [ENSMUST00000121803]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023335
AA Change: H493N

PolyPhen 2 Score 0.472 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000023335
Gene: ENSMUSG00000022656
AA Change: H493N

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
IG 63 167 5.04e-9 SMART
Pfam:C2-set_2 173 257 2.5e-19 PFAM
Pfam:Ig_2 281 355 1.3e-6 PFAM
transmembrane domain 368 390 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119941
AA Change: H76N

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000121245
AA Change: H168N

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113146
Gene: ENSMUSG00000022656
AA Change: H168N

DomainStartEndE-ValueType
transmembrane domain 43 65 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121803
AA Change: H83N

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000124602
SMART Domains Protein: ENSMUSP00000115927
Gene: ENSMUSG00000022656

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Meta Mutation Damage Score 0.1725 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nectin family of proteins, which function as adhesion molecules at adherens junctions. This family member interacts with other nectin-like proteins and with afadin, a filamentous actin-binding protein involved in the regulation of directional motility, cell proliferation and survival. This gene plays a role in ocular development involving the ciliary body. Mutations in this gene are believed to result in congenital ocular defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice exhibit male infertility and eye abnormalities including microphthalmia, absent vitreous body, abnormal ciliary body, retinal layers, and lenses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik A T 15: 84,960,592 W75R probably damaging Het
Abca15 T C 7: 120,340,205 V274A probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ap1m2 T C 9: 21,296,501 Y396C probably damaging Het
Apob T C 12: 8,015,874 S405P probably benign Het
Arhgap26 G T 18: 39,286,585 G533* probably null Het
Atxn2l T C 7: 126,503,165 probably benign Het
Ccdc88c A T 12: 100,941,128 L995H probably damaging Het
Cep192 A G 18: 67,837,997 H1023R possibly damaging Het
Cog5 T A 12: 31,886,221 M589K possibly damaging Het
Col25a1 C A 3: 130,535,465 P337Q probably damaging Het
Cyfip1 T G 7: 55,873,480 V51G possibly damaging Het
Dnah7b A T 1: 46,253,466 I3004F probably damaging Het
Dsg3 A T 18: 20,538,512 D758V probably damaging Het
Dsg3 A G 18: 20,520,477 probably null Het
Eml5 A T 12: 98,861,251 H573Q probably damaging Het
Erp27 T C 6: 136,908,203 D199G probably damaging Het
Flnb A G 14: 7,894,635 Y811C possibly damaging Het
G6pd2 A T 5: 61,809,250 S123C probably benign Het
Gm17677 T A 9: 35,741,544 C27* probably null Het
Gm1818 T A 12: 48,555,536 noncoding transcript Het
Gm29340 C T 2: 116,968,038 noncoding transcript Het
Gm8298 A G 3: 59,868,903 K165R possibly damaging Het
Hcn2 G T 10: 79,733,908 G581W probably damaging Het
Hist1h2bf C A 13: 23,574,136 probably benign Het
Kidins220 T C 12: 24,992,314 probably null Het
Lonp1 T C 17: 56,614,457 E926G probably benign Het
Lrp1 T C 10: 127,560,157 I2415V probably benign Het
Mmel1 C T 4: 154,895,018 H728Y probably damaging Het
Mmp10 A G 9: 7,503,632 probably null Het
Myo16 T A 8: 10,569,877 I1476N probably benign Het
Nov A G 15: 54,749,360 D255G probably benign Het
Nphs2 G A 1: 156,325,951 R204Q probably damaging Het
Olfr194 T C 16: 59,119,893 Y59C probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr920 T A 9: 38,756,066 I126N probably damaging Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Psme2b T C 11: 48,945,925 D65G probably damaging Het
Rlf T C 4: 121,154,975 K214E probably damaging Het
Rnasel A T 1: 153,754,460 T241S probably damaging Het
Samd9l C G 6: 3,377,252 G3A probably benign Het
Smg7 A G 1: 152,845,211 probably null Het
Spag16 A G 1: 70,725,083 probably null Het
Spata31d1c T A 13: 65,035,671 D342E probably benign Het
Stab2 A G 10: 86,883,778 probably null Het
Taar7b A T 10: 24,000,717 Y260F probably benign Het
Vcpip1 T C 1: 9,747,292 I289V probably damaging Het
Vmn2r39 A G 7: 9,014,964 V791A probably damaging Het
Vmn2r66 T A 7: 84,995,016 I729F probably damaging Het
Vmn2r-ps130 C T 17: 23,063,655 A103V probably benign Het
Zfp536 T A 7: 37,569,712 D93V probably damaging Het
Other mutations in Nectin3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01456:Nectin3 APN 16 46458853 missense probably benign 0.23
R0373:Nectin3 UTSW 16 46458187 missense probably damaging 0.99
R0550:Nectin3 UTSW 16 46458820 missense possibly damaging 0.86
R1219:Nectin3 UTSW 16 46454679 nonsense probably null
R1251:Nectin3 UTSW 16 46463842 missense possibly damaging 0.82
R1398:Nectin3 UTSW 16 46448756 missense possibly damaging 0.95
R1439:Nectin3 UTSW 16 46448394 nonsense probably null
R2250:Nectin3 UTSW 16 46454736 missense probably benign 0.00
R2448:Nectin3 UTSW 16 46448515 splice site probably null
R2483:Nectin3 UTSW 16 46395179 missense possibly damaging 0.83
R4523:Nectin3 UTSW 16 46448590 missense probably benign 0.15
R4709:Nectin3 UTSW 16 46463943 missense possibly damaging 0.58
R4809:Nectin3 UTSW 16 46448160 intron probably benign
R4884:Nectin3 UTSW 16 46448886 missense probably benign 0.01
R5051:Nectin3 UTSW 16 46448550 missense possibly damaging 0.95
R5061:Nectin3 UTSW 16 46448449 missense probably benign 0.03
R5272:Nectin3 UTSW 16 46448476 missense possibly damaging 0.82
R5365:Nectin3 UTSW 16 46464106 nonsense probably null
R5768:Nectin3 UTSW 16 46458817 missense probably damaging 0.98
R5987:Nectin3 UTSW 16 46464145 missense probably benign 0.00
R6029:Nectin3 UTSW 16 46436400 missense probably benign 0.08
R6251:Nectin3 UTSW 16 46395150 missense probably damaging 0.99
R6299:Nectin3 UTSW 16 46463982 missense probably damaging 0.98
R6347:Nectin3 UTSW 16 46458124 missense probably benign 0.01
R6360:Nectin3 UTSW 16 46411109 missense probably benign 0.09
R6505:Nectin3 UTSW 16 46448821 missense possibly damaging 0.68
R6703:Nectin3 UTSW 16 46463842 missense probably damaging 0.99
R6869:Nectin3 UTSW 16 46395143 missense probably damaging 0.96
R7184:Nectin3 UTSW 16 46395121 missense possibly damaging 0.66
R7298:Nectin3 UTSW 16 46448396 missense probably damaging 1.00
R7455:Nectin3 UTSW 16 46496742 nonsense probably null
R7973:Nectin3 UTSW 16 46396121 missense probably benign 0.13
R7993:Nectin3 UTSW 16 46458821 missense probably benign 0.01
R8108:Nectin3 UTSW 16 46464121 missense possibly damaging 0.84
R8259:Nectin3 UTSW 16 46436391 missense probably benign 0.00
R8511:Nectin3 UTSW 16 46464000 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCATCGATCGTTGCAAC -3'
(R):5'- CCATCCAGTTCCTTTGAGGG -3'

Sequencing Primer
(F):5'- CGATCGTTGCAACACACTTTAAG -3'
(R):5'- TGTTTTCACCAGTGTCCTAGAAG -3'
Posted On2017-10-10