Incidental Mutation 'R6131:Arhgap26'
ID 487158
Institutional Source Beutler Lab
Gene Symbol Arhgap26
Ensembl Gene ENSMUSG00000036452
Gene Name Rho GTPase activating protein 26
Synonyms 4933432P15Rik, 2610010G17Rik, 1810044B20Rik
MMRRC Submission 044278-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6131 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 38734531-39509338 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 39419638 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Stop codon at position 533 (G533*)
Ref Sequence ENSEMBL: ENSMUSP00000122371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097593] [ENSMUST00000137497] [ENSMUST00000155576]
AlphaFold Q6ZQ82
Predicted Effect probably null
Transcript: ENSMUST00000097593
AA Change: G533*
SMART Domains Protein: ENSMUSP00000095200
Gene: ENSMUSG00000036452
AA Change: G533*

DomainStartEndE-ValueType
Pfam:BAR_3 6 249 1.8e-90 PFAM
Pfam:IMD 26 231 2.8e-9 PFAM
PH 266 371 3.23e-8 SMART
RhoGAP 387 565 4.51e-65 SMART
low complexity region 584 600 N/A INTRINSIC
low complexity region 617 652 N/A INTRINSIC
low complexity region 657 701 N/A INTRINSIC
SH3 759 814 5.11e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128894
Predicted Effect probably benign
Transcript: ENSMUST00000137497
SMART Domains Protein: ENSMUSP00000121197
Gene: ENSMUSG00000036452

DomainStartEndE-ValueType
PDB:1F7C|A 1 32 7e-9 PDB
Blast:RhoGAP 16 65 2e-9 BLAST
low complexity region 66 101 N/A INTRINSIC
SH3 116 171 5.11e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148399
Predicted Effect probably null
Transcript: ENSMUST00000154551
AA Change: G151*
SMART Domains Protein: ENSMUSP00000123145
Gene: ENSMUSG00000036452
AA Change: G151*

DomainStartEndE-ValueType
RhoGAP 6 184 4.51e-65 SMART
low complexity region 203 219 N/A INTRINSIC
low complexity region 236 271 N/A INTRINSIC
low complexity region 276 317 N/A INTRINSIC
SH3 333 388 5.11e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000155576
AA Change: G533*
SMART Domains Protein: ENSMUSP00000122371
Gene: ENSMUSG00000036452
AA Change: G533*

DomainStartEndE-ValueType
Pfam:IMD 27 232 1.2e-8 PFAM
PH 266 371 3.23e-8 SMART
RhoGAP 387 565 4.51e-65 SMART
low complexity region 584 600 N/A INTRINSIC
low complexity region 617 652 N/A INTRINSIC
low complexity region 657 702 N/A INTRINSIC
SH3 704 759 5.11e-14 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interaction of a cell with the extracellular matrix triggers integrin cell surface receptors to begin signaling cascades that regulate the organization of the actin-cytoskeleton. One of the proteins involved in these cascades is focal adhesion kinase. The protein encoded by this gene is a GTPase activating protein that binds to focal adhesion kinase and mediates the activity of the GTP binding proteins RhoA and Cdc42. Defects in this gene are a cause of juvenile myelomonocytic leukemia (JMML). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous for a hypomorphic allele display reduced myofiber size, impaired myoblast fusion and abnormal muscle regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik A T 15: 84,844,793 (GRCm39) W75R probably damaging Het
Aadacl2fm3 A G 3: 59,776,324 (GRCm39) K165R possibly damaging Het
Abca15 T C 7: 119,939,428 (GRCm39) V274A probably benign Het
Afg3l2 G T 18: 67,554,329 (GRCm39) L458M probably damaging Het
Ap1m2 T C 9: 21,207,797 (GRCm39) Y396C probably damaging Het
Apob T C 12: 8,065,874 (GRCm39) S405P probably benign Het
Atxn2l T C 7: 126,102,337 (GRCm39) probably benign Het
Ccdc88c A T 12: 100,907,387 (GRCm39) L995H probably damaging Het
Ccn3 A G 15: 54,612,756 (GRCm39) D255G probably benign Het
Cep192 A G 18: 67,971,068 (GRCm39) H1023R possibly damaging Het
Cog5 T A 12: 31,936,220 (GRCm39) M589K possibly damaging Het
Col25a1 C A 3: 130,329,114 (GRCm39) P337Q probably damaging Het
Cyfip1 T G 7: 55,523,228 (GRCm39) V51G possibly damaging Het
Dnah7b A T 1: 46,292,626 (GRCm39) I3004F probably damaging Het
Dsg3 A T 18: 20,671,569 (GRCm39) D758V probably damaging Het
Dsg3 A G 18: 20,653,534 (GRCm39) probably null Het
Eml5 A T 12: 98,827,510 (GRCm39) H573Q probably damaging Het
Erp27 T C 6: 136,885,201 (GRCm39) D199G probably damaging Het
Flnb A G 14: 7,894,635 (GRCm38) Y811C possibly damaging Het
G6pd2 A T 5: 61,966,593 (GRCm39) S123C probably benign Het
Gm1818 T A 12: 48,602,319 (GRCm39) noncoding transcript Het
Gm29340 C T 2: 116,798,519 (GRCm39) noncoding transcript Het
H2bc7 C A 13: 23,758,310 (GRCm39) probably benign Het
Hcn2 G T 10: 79,569,742 (GRCm39) G581W probably damaging Het
Kidins220 T C 12: 25,042,313 (GRCm39) probably null Het
Lonp1 T C 17: 56,921,457 (GRCm39) E926G probably benign Het
Lrp1 T C 10: 127,396,026 (GRCm39) I2415V probably benign Het
Mmel1 C T 4: 154,979,475 (GRCm39) H728Y probably damaging Het
Mmp10 A G 9: 7,503,633 (GRCm39) probably null Het
Myo16 T A 8: 10,619,877 (GRCm39) I1476N probably benign Het
Nectin3 G T 16: 46,215,515 (GRCm39) H76N probably damaging Het
Nphs2 G A 1: 156,153,521 (GRCm39) R204Q probably damaging Het
Or5ac15 T C 16: 58,940,256 (GRCm39) Y59C probably damaging Het
Or8b36 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 37,937,836 (GRCm39) probably null Het
Or8b53 T A 9: 38,667,362 (GRCm39) I126N probably damaging Het
Otx1 A T 11: 21,949,406 (GRCm39) L24H probably damaging Het
Pate10 T A 9: 35,652,840 (GRCm39) C27* probably null Het
Psme2b T C 11: 48,836,752 (GRCm39) D65G probably damaging Het
Rlf T C 4: 121,012,172 (GRCm39) K214E probably damaging Het
Rnasel A T 1: 153,630,206 (GRCm39) T241S probably damaging Het
Samd9l C G 6: 3,377,252 (GRCm39) G3A probably benign Het
Smg7 A G 1: 152,720,962 (GRCm39) probably null Het
Spag16 A G 1: 70,764,242 (GRCm39) probably null Het
Spata31d1c T A 13: 65,183,485 (GRCm39) D342E probably benign Het
Stab2 A G 10: 86,719,642 (GRCm39) probably null Het
Taar7b A T 10: 23,876,615 (GRCm39) Y260F probably benign Het
Vcpip1 T C 1: 9,817,517 (GRCm39) I289V probably damaging Het
Vmn2r130 C T 17: 23,282,629 (GRCm39) A103V probably benign Het
Vmn2r39 A G 7: 9,017,963 (GRCm39) V791A probably damaging Het
Vmn2r66 T A 7: 84,644,224 (GRCm39) I729F probably damaging Het
Zfp536 T A 7: 37,269,137 (GRCm39) D93V probably damaging Het
Other mutations in Arhgap26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Arhgap26 APN 18 39,419,604 (GRCm39) missense probably damaging 1.00
IGL01116:Arhgap26 APN 18 39,244,856 (GRCm39) missense probably damaging 0.97
IGL01409:Arhgap26 APN 18 39,243,504 (GRCm39) splice site probably benign
IGL02316:Arhgap26 APN 18 38,775,599 (GRCm39) exon noncoding transcript
IGL02418:Arhgap26 APN 18 39,490,620 (GRCm39) intron probably benign
IGL02588:Arhgap26 APN 18 38,734,670 (GRCm39) unclassified probably benign
IGL03241:Arhgap26 APN 18 39,362,970 (GRCm39) missense probably damaging 1.00
R0184:Arhgap26 UTSW 18 38,750,726 (GRCm39) missense unknown
R0244:Arhgap26 UTSW 18 39,496,184 (GRCm39) missense probably benign 0.05
R0347:Arhgap26 UTSW 18 38,750,797 (GRCm39) missense unknown
R1533:Arhgap26 UTSW 18 39,504,130 (GRCm39) missense probably benign 0.16
R1606:Arhgap26 UTSW 18 39,429,925 (GRCm39) missense probably damaging 1.00
R2066:Arhgap26 UTSW 18 39,439,781 (GRCm39) missense probably damaging 1.00
R2182:Arhgap26 UTSW 18 39,490,862 (GRCm39) intron probably benign
R2291:Arhgap26 UTSW 18 39,490,751 (GRCm39) intron probably benign
R3611:Arhgap26 UTSW 18 39,066,972 (GRCm39) missense probably benign
R3700:Arhgap26 UTSW 18 39,253,237 (GRCm39) missense probably damaging 0.99
R3887:Arhgap26 UTSW 18 39,363,019 (GRCm39) critical splice donor site probably null
R4621:Arhgap26 UTSW 18 39,032,894 (GRCm39) intron probably benign
R4877:Arhgap26 UTSW 18 39,429,982 (GRCm39) splice site probably null
R4910:Arhgap26 UTSW 18 39,126,690 (GRCm39) splice site probably benign
R4911:Arhgap26 UTSW 18 39,126,690 (GRCm39) splice site probably benign
R4954:Arhgap26 UTSW 18 39,376,694 (GRCm39) missense probably benign 0.00
R4967:Arhgap26 UTSW 18 39,379,893 (GRCm39) missense probably damaging 1.00
R5221:Arhgap26 UTSW 18 39,243,525 (GRCm39) nonsense probably null
R5232:Arhgap26 UTSW 18 39,126,529 (GRCm39) start codon destroyed probably null 0.97
R5297:Arhgap26 UTSW 18 39,254,941 (GRCm39) missense probably damaging 1.00
R5372:Arhgap26 UTSW 18 38,775,509 (GRCm39) exon noncoding transcript
R5570:Arhgap26 UTSW 18 39,232,671 (GRCm39) missense probably damaging 0.99
R5692:Arhgap26 UTSW 18 39,254,945 (GRCm39) missense probably damaging 1.00
R5752:Arhgap26 UTSW 18 39,419,725 (GRCm39) missense probably damaging 1.00
R5930:Arhgap26 UTSW 18 39,283,145 (GRCm39) missense probably damaging 0.96
R6251:Arhgap26 UTSW 18 39,490,880 (GRCm39) missense probably null
R6481:Arhgap26 UTSW 18 39,283,110 (GRCm39) missense probably damaging 1.00
R6622:Arhgap26 UTSW 18 39,032,916 (GRCm39) intron probably benign
R6799:Arhgap26 UTSW 18 39,232,660 (GRCm39) missense probably damaging 1.00
R6878:Arhgap26 UTSW 18 39,360,465 (GRCm39) missense probably damaging 1.00
R6989:Arhgap26 UTSW 18 39,232,682 (GRCm39) missense probably damaging 1.00
R7248:Arhgap26 UTSW 18 39,439,907 (GRCm39) critical splice donor site probably null
R7936:Arhgap26 UTSW 18 39,338,340 (GRCm39) missense probably damaging 1.00
R7960:Arhgap26 UTSW 18 39,362,980 (GRCm39) missense
R8103:Arhgap26 UTSW 18 39,504,177 (GRCm39) missense
R8206:Arhgap26 UTSW 18 39,439,803 (GRCm39) nonsense probably null
R8356:Arhgap26 UTSW 18 39,244,901 (GRCm39) missense possibly damaging 0.89
R8456:Arhgap26 UTSW 18 39,244,901 (GRCm39) missense possibly damaging 0.89
R8987:Arhgap26 UTSW 18 39,490,652 (GRCm39) missense
R9025:Arhgap26 UTSW 18 39,379,898 (GRCm39) missense
R9149:Arhgap26 UTSW 18 39,244,917 (GRCm39) missense possibly damaging 0.94
R9172:Arhgap26 UTSW 18 39,378,382 (GRCm39) missense probably damaging 1.00
R9191:Arhgap26 UTSW 18 39,439,893 (GRCm39) missense
R9576:Arhgap26 UTSW 18 39,253,207 (GRCm39) nonsense probably null
X0013:Arhgap26 UTSW 18 39,504,165 (GRCm39) missense probably damaging 1.00
X0025:Arhgap26 UTSW 18 39,283,158 (GRCm39) missense probably damaging 1.00
Z1088:Arhgap26 UTSW 18 39,490,724 (GRCm39) splice site probably benign
Predicted Primers PCR Primer
(F):5'- AACTTGCTCTTTGATTCATGGC -3'
(R):5'- GCCGTTAGCAATGCAAACC -3'

Sequencing Primer
(F):5'- CATCCAGAGATGTCCCGAGTCTTG -3'
(R):5'- CTAGCCTGAAGGTAAGTCCCAGTG -3'
Posted On 2017-10-10