Incidental Mutation 'R6131:Arhgap26'
ID487158
Institutional Source Beutler Lab
Gene Symbol Arhgap26
Ensembl Gene ENSMUSG00000036452
Gene NameRho GTPase activating protein 26
Synonyms2610010G17Rik, 1810044B20Rik, 4933432P15Rik
MMRRC Submission 044278-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6131 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location38601534-39376284 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 39286585 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Stop codon at position 533 (G533*)
Ref Sequence ENSEMBL: ENSMUSP00000122371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097593] [ENSMUST00000137497] [ENSMUST00000155576]
Predicted Effect probably null
Transcript: ENSMUST00000097593
AA Change: G533*
SMART Domains Protein: ENSMUSP00000095200
Gene: ENSMUSG00000036452
AA Change: G533*

DomainStartEndE-ValueType
Pfam:BAR_3 6 249 1.8e-90 PFAM
Pfam:IMD 26 231 2.8e-9 PFAM
PH 266 371 3.23e-8 SMART
RhoGAP 387 565 4.51e-65 SMART
low complexity region 584 600 N/A INTRINSIC
low complexity region 617 652 N/A INTRINSIC
low complexity region 657 701 N/A INTRINSIC
SH3 759 814 5.11e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128894
Predicted Effect probably benign
Transcript: ENSMUST00000137497
SMART Domains Protein: ENSMUSP00000121197
Gene: ENSMUSG00000036452

DomainStartEndE-ValueType
PDB:1F7C|A 1 32 7e-9 PDB
Blast:RhoGAP 16 65 2e-9 BLAST
low complexity region 66 101 N/A INTRINSIC
SH3 116 171 5.11e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148399
Predicted Effect probably null
Transcript: ENSMUST00000154551
AA Change: G151*
SMART Domains Protein: ENSMUSP00000123145
Gene: ENSMUSG00000036452
AA Change: G151*

DomainStartEndE-ValueType
RhoGAP 6 184 4.51e-65 SMART
low complexity region 203 219 N/A INTRINSIC
low complexity region 236 271 N/A INTRINSIC
low complexity region 276 317 N/A INTRINSIC
SH3 333 388 5.11e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000155576
AA Change: G533*
SMART Domains Protein: ENSMUSP00000122371
Gene: ENSMUSG00000036452
AA Change: G533*

DomainStartEndE-ValueType
Pfam:IMD 27 232 1.2e-8 PFAM
PH 266 371 3.23e-8 SMART
RhoGAP 387 565 4.51e-65 SMART
low complexity region 584 600 N/A INTRINSIC
low complexity region 617 652 N/A INTRINSIC
low complexity region 657 702 N/A INTRINSIC
SH3 704 759 5.11e-14 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interaction of a cell with the extracellular matrix triggers integrin cell surface receptors to begin signaling cascades that regulate the organization of the actin-cytoskeleton. One of the proteins involved in these cascades is focal adhesion kinase. The protein encoded by this gene is a GTPase activating protein that binds to focal adhesion kinase and mediates the activity of the GTP binding proteins RhoA and Cdc42. Defects in this gene are a cause of juvenile myelomonocytic leukemia (JMML). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous for a hypomorphic allele display reduced myofiber size, impaired myoblast fusion and abnormal muscle regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik A T 15: 84,960,592 W75R probably damaging Het
Abca15 T C 7: 120,340,205 V274A probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ap1m2 T C 9: 21,296,501 Y396C probably damaging Het
Apob T C 12: 8,015,874 S405P probably benign Het
Atxn2l T C 7: 126,503,165 probably benign Het
Ccdc88c A T 12: 100,941,128 L995H probably damaging Het
Cep192 A G 18: 67,837,997 H1023R possibly damaging Het
Cog5 T A 12: 31,886,221 M589K possibly damaging Het
Col25a1 C A 3: 130,535,465 P337Q probably damaging Het
Cyfip1 T G 7: 55,873,480 V51G possibly damaging Het
Dnah7b A T 1: 46,253,466 I3004F probably damaging Het
Dsg3 A T 18: 20,538,512 D758V probably damaging Het
Dsg3 A G 18: 20,520,477 probably null Het
Eml5 A T 12: 98,861,251 H573Q probably damaging Het
Erp27 T C 6: 136,908,203 D199G probably damaging Het
Flnb A G 14: 7,894,635 Y811C possibly damaging Het
G6pd2 A T 5: 61,809,250 S123C probably benign Het
Gm17677 T A 9: 35,741,544 C27* probably null Het
Gm1818 T A 12: 48,555,536 noncoding transcript Het
Gm29340 C T 2: 116,968,038 noncoding transcript Het
Gm8298 A G 3: 59,868,903 K165R possibly damaging Het
Hcn2 G T 10: 79,733,908 G581W probably damaging Het
Hist1h2bf C A 13: 23,574,136 probably benign Het
Kidins220 T C 12: 24,992,314 probably null Het
Lonp1 T C 17: 56,614,457 E926G probably benign Het
Lrp1 T C 10: 127,560,157 I2415V probably benign Het
Mmel1 C T 4: 154,895,018 H728Y probably damaging Het
Mmp10 A G 9: 7,503,632 probably null Het
Myo16 T A 8: 10,569,877 I1476N probably benign Het
Nectin3 G T 16: 46,395,152 H76N probably damaging Het
Nov A G 15: 54,749,360 D255G probably benign Het
Nphs2 G A 1: 156,325,951 R204Q probably damaging Het
Olfr194 T C 16: 59,119,893 Y59C probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr920 T A 9: 38,756,066 I126N probably damaging Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Psme2b T C 11: 48,945,925 D65G probably damaging Het
Rlf T C 4: 121,154,975 K214E probably damaging Het
Rnasel A T 1: 153,754,460 T241S probably damaging Het
Samd9l C G 6: 3,377,252 G3A probably benign Het
Smg7 A G 1: 152,845,211 probably null Het
Spag16 A G 1: 70,725,083 probably null Het
Spata31d1c T A 13: 65,035,671 D342E probably benign Het
Stab2 A G 10: 86,883,778 probably null Het
Taar7b A T 10: 24,000,717 Y260F probably benign Het
Vcpip1 T C 1: 9,747,292 I289V probably damaging Het
Vmn2r39 A G 7: 9,014,964 V791A probably damaging Het
Vmn2r66 T A 7: 84,995,016 I729F probably damaging Het
Vmn2r-ps130 C T 17: 23,063,655 A103V probably benign Het
Zfp536 T A 7: 37,569,712 D93V probably damaging Het
Other mutations in Arhgap26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Arhgap26 APN 18 39286551 missense probably damaging 1.00
IGL01116:Arhgap26 APN 18 39111803 missense probably damaging 0.97
IGL01409:Arhgap26 APN 18 39110451 splice site probably benign
IGL02316:Arhgap26 APN 18 38642546 exon noncoding transcript
IGL02418:Arhgap26 APN 18 39357567 intron probably benign
IGL02588:Arhgap26 APN 18 38601617 unclassified probably benign
IGL03241:Arhgap26 APN 18 39229917 missense probably damaging 1.00
R0184:Arhgap26 UTSW 18 38617673 missense unknown
R0244:Arhgap26 UTSW 18 39363131 missense probably benign 0.05
R0347:Arhgap26 UTSW 18 38617744 missense unknown
R1533:Arhgap26 UTSW 18 39371077 missense probably benign 0.16
R1606:Arhgap26 UTSW 18 39296872 missense probably damaging 1.00
R2066:Arhgap26 UTSW 18 39306728 missense probably damaging 1.00
R2182:Arhgap26 UTSW 18 39357809 intron probably benign
R2291:Arhgap26 UTSW 18 39357698 intron probably benign
R3611:Arhgap26 UTSW 18 38933919 missense probably benign
R3700:Arhgap26 UTSW 18 39120184 missense probably damaging 0.99
R3887:Arhgap26 UTSW 18 39229966 critical splice donor site probably null
R4621:Arhgap26 UTSW 18 38899841 intron probably benign
R4877:Arhgap26 UTSW 18 39296929 splice site probably null
R4910:Arhgap26 UTSW 18 38993637 splice site probably benign
R4911:Arhgap26 UTSW 18 38993637 splice site probably benign
R4954:Arhgap26 UTSW 18 39243641 missense probably benign 0.00
R4967:Arhgap26 UTSW 18 39246840 missense probably damaging 1.00
R5221:Arhgap26 UTSW 18 39110472 nonsense probably null
R5232:Arhgap26 UTSW 18 38993476 start codon destroyed probably null 0.97
R5297:Arhgap26 UTSW 18 39121888 missense probably damaging 1.00
R5372:Arhgap26 UTSW 18 38642456 exon noncoding transcript
R5570:Arhgap26 UTSW 18 39099618 missense probably damaging 0.99
R5692:Arhgap26 UTSW 18 39121892 missense probably damaging 1.00
R5752:Arhgap26 UTSW 18 39286672 missense probably damaging 1.00
R5930:Arhgap26 UTSW 18 39150092 missense probably damaging 0.96
R6251:Arhgap26 UTSW 18 39357827 missense probably null
R6481:Arhgap26 UTSW 18 39150057 missense probably damaging 1.00
R6622:Arhgap26 UTSW 18 38899863 intron probably benign
R6799:Arhgap26 UTSW 18 39099607 missense probably damaging 1.00
R6878:Arhgap26 UTSW 18 39227412 missense probably damaging 1.00
R6989:Arhgap26 UTSW 18 39099629 missense probably damaging 1.00
R7248:Arhgap26 UTSW 18 39306854 critical splice donor site probably null
R7936:Arhgap26 UTSW 18 39205287 missense probably damaging 1.00
R7960:Arhgap26 UTSW 18 39229927 missense
R8103:Arhgap26 UTSW 18 39371124 missense
R8206:Arhgap26 UTSW 18 39306750 nonsense probably null
R8356:Arhgap26 UTSW 18 39111848 missense possibly damaging 0.89
R8456:Arhgap26 UTSW 18 39111848 missense possibly damaging 0.89
X0013:Arhgap26 UTSW 18 39371112 missense probably damaging 1.00
X0025:Arhgap26 UTSW 18 39150105 missense probably damaging 1.00
Z1088:Arhgap26 UTSW 18 39357671 splice site probably benign
Predicted Primers PCR Primer
(F):5'- AACTTGCTCTTTGATTCATGGC -3'
(R):5'- GCCGTTAGCAATGCAAACC -3'

Sequencing Primer
(F):5'- CATCCAGAGATGTCCCGAGTCTTG -3'
(R):5'- CTAGCCTGAAGGTAAGTCCCAGTG -3'
Posted On2017-10-10