Mutagenetix > Incidental Mutations

Incidental Mutation 'R6131:Arhgap26'

487158

Institutional Source

Beutler Lab

Gene Symbol

Arhgap26

Ensembl Gene

ENSMUSG00000036452

Gene Name

Rho GTPase activating protein 26

Synonyms

2610010G17Rik, 1810044B20Rik, 4933432P15Rik

MMRRC Submission

044278-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6131 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

38601534-39376284 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 39286585 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Stop codon at position 533 (G533*)

Ref Sequence

ENSEMBL: ENSMUSP00000122371 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097593] [ENSMUST00000137497] [ENSMUST00000155576]

Predicted Effect

probably null
Transcript: ENSMUST00000097593
AA Change: G533*

SMART Domains

Protein: ENSMUSP00000095200
Gene: ENSMUSG00000036452
AA Change: G533*

Domain	Start	End	E-Value	Type
Pfam:BAR_3	6	249	1.8e-90	PFAM
Pfam:IMD	26	231	2.8e-9	PFAM
PH	266	371	3.23e-8	SMART
RhoGAP	387	565	4.51e-65	SMART
low complexity region	584	600	N/A	INTRINSIC
low complexity region	617	652	N/A	INTRINSIC
low complexity region	657	701	N/A	INTRINSIC
SH3	759	814	5.11e-14	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128894

Predicted Effect

probably benign
Transcript: ENSMUST00000137497

SMART Domains

Protein: ENSMUSP00000121197
Gene: ENSMUSG00000036452

Domain	Start	End	E-Value	Type
PDB:1F7C\|A	1	32	7e-9	PDB
Blast:RhoGAP	16	65	2e-9	BLAST
low complexity region	66	101	N/A	INTRINSIC
SH3	116	171	5.11e-14	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148399

Predicted Effect

probably null
Transcript: ENSMUST00000154551
AA Change: G151*

SMART Domains

Protein: ENSMUSP00000123145
Gene: ENSMUSG00000036452
AA Change: G151*

Domain	Start	End	E-Value	Type
RhoGAP	6	184	4.51e-65	SMART
low complexity region	203	219	N/A	INTRINSIC
low complexity region	236	271	N/A	INTRINSIC
low complexity region	276	317	N/A	INTRINSIC
SH3	333	388	5.11e-14	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000155576
AA Change: G533*

SMART Domains

Protein: ENSMUSP00000122371
Gene: ENSMUSG00000036452
AA Change: G533*

Domain	Start	End	E-Value	Type
Pfam:IMD	27	232	1.2e-8	PFAM
PH	266	371	3.23e-8	SMART
RhoGAP	387	565	4.51e-65	SMART
low complexity region	584	600	N/A	INTRINSIC
low complexity region	617	652	N/A	INTRINSIC
low complexity region	657	702	N/A	INTRINSIC
SH3	704	759	5.11e-14	SMART

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.8%

Validation Efficiency

96% (50/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interaction of a cell with the extracellular matrix triggers integrin cell surface receptors to begin signaling cascades that regulate the organization of the actin-cytoskeleton. One of the proteins involved in these cascades is focal adhesion kinase. The protein encoded by this gene is a GTPase activating protein that binds to focal adhesion kinase and mediates the activity of the GTP binding proteins RhoA and Cdc42. Defects in this gene are a cause of juvenile myelomonocytic leukemia (JMML). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous for a hypomorphic allele display reduced myofiber size, impaired myoblast fusion and abnormal muscle regeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5031439G07Rik	A	T	15: 84,960,592	W75R	probably damaging	Het
Abca15	T	C	7: 120,340,205	V274A	probably benign	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Ap1m2	T	C	9: 21,296,501	Y396C	probably damaging	Het
Apob	T	C	12: 8,015,874	S405P	probably benign	Het
Atxn2l	T	C	7: 126,503,165		probably benign	Het
Ccdc88c	A	T	12: 100,941,128	L995H	probably damaging	Het
Cep192	A	G	18: 67,837,997	H1023R	possibly damaging	Het
Cog5	T	A	12: 31,886,221	M589K	possibly damaging	Het
Col25a1	C	A	3: 130,535,465	P337Q	probably damaging	Het
Cyfip1	T	G	7: 55,873,480	V51G	possibly damaging	Het
Dnah7b	A	T	1: 46,253,466	I3004F	probably damaging	Het
Dsg3	A	T	18: 20,538,512	D758V	probably damaging	Het
Dsg3	A	G	18: 20,520,477		probably null	Het
Eml5	A	T	12: 98,861,251	H573Q	probably damaging	Het
Erp27	T	C	6: 136,908,203	D199G	probably damaging	Het
Flnb	A	G	14: 7,894,635	Y811C	possibly damaging	Het
G6pd2	A	T	5: 61,809,250	S123C	probably benign	Het
Gm17677	T	A	9: 35,741,544	C27*	probably null	Het
Gm1818	T	A	12: 48,555,536		noncoding transcript	Het
Gm29340	C	T	2: 116,968,038		noncoding transcript	Het
Gm8298	A	G	3: 59,868,903	K165R	possibly damaging	Het
Hcn2	G	T	10: 79,733,908	G581W	probably damaging	Het
Hist1h2bf	C	A	13: 23,574,136		probably benign	Het
Kidins220	T	C	12: 24,992,314		probably null	Het
Lonp1	T	C	17: 56,614,457	E926G	probably benign	Het
Lrp1	T	C	10: 127,560,157	I2415V	probably benign	Het
Mmel1	C	T	4: 154,895,018	H728Y	probably damaging	Het
Mmp10	A	G	9: 7,503,632		probably null	Het
Myo16	T	A	8: 10,569,877	I1476N	probably benign	Het
Nectin3	G	T	16: 46,395,152	H76N	probably damaging	Het
Nov	A	G	15: 54,749,360	D255G	probably benign	Het
Nphs2	G	A	1: 156,325,951	R204Q	probably damaging	Het
Olfr194	T	C	16: 59,119,893	Y59C	probably damaging	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
Olfr920	T	A	9: 38,756,066	I126N	probably damaging	Het
Otx1	A	T	11: 21,999,406	L24H	probably damaging	Het
Psme2b	T	C	11: 48,945,925	D65G	probably damaging	Het
Rlf	T	C	4: 121,154,975	K214E	probably damaging	Het
Rnasel	A	T	1: 153,754,460	T241S	probably damaging	Het
Samd9l	C	G	6: 3,377,252	G3A	probably benign	Het
Smg7	A	G	1: 152,845,211		probably null	Het
Spag16	A	G	1: 70,725,083		probably null	Het
Spata31d1c	T	A	13: 65,035,671	D342E	probably benign	Het
Stab2	A	G	10: 86,883,778		probably null	Het
Taar7b	A	T	10: 24,000,717	Y260F	probably benign	Het
Vcpip1	T	C	1: 9,747,292	I289V	probably damaging	Het
Vmn2r39	A	G	7: 9,014,964	V791A	probably damaging	Het
Vmn2r66	T	A	7: 84,995,016	I729F	probably damaging	Het
Vmn2r-ps130	C	T	17: 23,063,655	A103V	probably benign	Het
Zfp536	T	A	7: 37,569,712	D93V	probably damaging	Het

Other mutations in Arhgap26

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00706:Arhgap26	APN	18	39286551	missense	probably damaging	1.00
IGL01116:Arhgap26	APN	18	39111803	missense	probably damaging	0.97
IGL01409:Arhgap26	APN	18	39110451	splice site	probably benign
IGL02316:Arhgap26	APN	18	38642546	exon	noncoding transcript
IGL02418:Arhgap26	APN	18	39357567	intron	probably benign
IGL02588:Arhgap26	APN	18	38601617	unclassified	probably benign
IGL03241:Arhgap26	APN	18	39229917	missense	probably damaging	1.00
R0184:Arhgap26	UTSW	18	38617673	missense	unknown
R0244:Arhgap26	UTSW	18	39363131	missense	probably benign	0.05
R0347:Arhgap26	UTSW	18	38617744	missense	unknown
R1533:Arhgap26	UTSW	18	39371077	missense	probably benign	0.16
R1606:Arhgap26	UTSW	18	39296872	missense	probably damaging	1.00
R2066:Arhgap26	UTSW	18	39306728	missense	probably damaging	1.00
R2182:Arhgap26	UTSW	18	39357809	intron	probably benign
R2291:Arhgap26	UTSW	18	39357698	intron	probably benign
R3611:Arhgap26	UTSW	18	38933919	missense	probably benign
R3700:Arhgap26	UTSW	18	39120184	missense	probably damaging	0.99
R3887:Arhgap26	UTSW	18	39229966	critical splice donor site	probably null
R4621:Arhgap26	UTSW	18	38899841	intron	probably benign
R4877:Arhgap26	UTSW	18	39296929	splice site	probably null
R4910:Arhgap26	UTSW	18	38993637	splice site	probably benign
R4911:Arhgap26	UTSW	18	38993637	splice site	probably benign
R4954:Arhgap26	UTSW	18	39243641	missense	probably benign	0.00
R4967:Arhgap26	UTSW	18	39246840	missense	probably damaging	1.00
R5221:Arhgap26	UTSW	18	39110472	nonsense	probably null
R5232:Arhgap26	UTSW	18	38993476	start codon destroyed	probably null	0.97
R5297:Arhgap26	UTSW	18	39121888	missense	probably damaging	1.00
R5372:Arhgap26	UTSW	18	38642456	exon	noncoding transcript
R5570:Arhgap26	UTSW	18	39099618	missense	probably damaging	0.99
R5692:Arhgap26	UTSW	18	39121892	missense	probably damaging	1.00
R5752:Arhgap26	UTSW	18	39286672	missense	probably damaging	1.00
R5930:Arhgap26	UTSW	18	39150092	missense	probably damaging	0.96
R6251:Arhgap26	UTSW	18	39357827	missense	probably null
R6481:Arhgap26	UTSW	18	39150057	missense	probably damaging	1.00
R6622:Arhgap26	UTSW	18	38899863	intron	probably benign
R6799:Arhgap26	UTSW	18	39099607	missense	probably damaging	1.00
R6878:Arhgap26	UTSW	18	39227412	missense	probably damaging	1.00
R6989:Arhgap26	UTSW	18	39099629	missense	probably damaging	1.00
R7248:Arhgap26	UTSW	18	39306854	critical splice donor site	probably null
R7936:Arhgap26	UTSW	18	39205287	missense	probably damaging	1.00
R7960:Arhgap26	UTSW	18	39229927	missense
R8103:Arhgap26	UTSW	18	39371124	missense
R8206:Arhgap26	UTSW	18	39306750	nonsense	probably null
R8356:Arhgap26	UTSW	18	39111848	missense	possibly damaging	0.89
R8456:Arhgap26	UTSW	18	39111848	missense	possibly damaging	0.89
X0013:Arhgap26	UTSW	18	39371112	missense	probably damaging	1.00
X0025:Arhgap26	UTSW	18	39150105	missense	probably damaging	1.00
Z1088:Arhgap26	UTSW	18	39357671	splice site	probably benign

Predicted Primers

PCR Primer
(F):5'- AACTTGCTCTTTGATTCATGGC -3'
(R):5'- GCCGTTAGCAATGCAAACC -3'

Sequencing Primer
(F):5'- CATCCAGAGATGTCCCGAGTCTTG -3'
(R):5'- CTAGCCTGAAGGTAAGTCCCAGTG -3'

Posted On

2017-10-10