Incidental Mutation 'R6132:Fbxo44'
ID487169
Institutional Source Beutler Lab
Gene Symbol Fbxo44
Ensembl Gene ENSMUSG00000029001
Gene NameF-box protein 44
SynonymsFBG3, Fbx6a, FBX30, Fbxo6a
MMRRC Submission 044279-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6132 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location148152800-148160482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 148156108 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 221 (T221I)
Ref Sequence ENSEMBL: ENSMUSP00000134064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030858] [ENSMUST00000047951] [ENSMUST00000056965] [ENSMUST00000057907] [ENSMUST00000105705] [ENSMUST00000105706] [ENSMUST00000122913] [ENSMUST00000129253] [ENSMUST00000132083] [ENSMUST00000134261] [ENSMUST00000151127] [ENSMUST00000151246] [ENSMUST00000152098] [ENSMUST00000167160] [ENSMUST00000168503] [ENSMUST00000172472] [ENSMUST00000173352]
Predicted Effect probably benign
Transcript: ENSMUST00000030858
SMART Domains Protein: ENSMUSP00000030858
Gene: ENSMUSG00000055401

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000047951
SMART Domains Protein: ENSMUSP00000037377
Gene: ENSMUSG00000041556

DomainStartEndE-ValueType
Pfam:F-box 50 97 3.8e-9 PFAM
Pfam:F-box-like 51 97 9.3e-8 PFAM
FBA 114 297 3.81e-104 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000056965
SMART Domains Protein: ENSMUSP00000062348
Gene: ENSMUSG00000055401

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000057907
SMART Domains Protein: ENSMUSP00000054022
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 252 2.24e-110 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105705
SMART Domains Protein: ENSMUSP00000101330
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 196 2.79e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105706
SMART Domains Protein: ENSMUSP00000101331
Gene: ENSMUSG00000055401

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122913
SMART Domains Protein: ENSMUSP00000120874
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
Pfam:FBA 68 115 3e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129253
SMART Domains Protein: ENSMUSP00000117013
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 213 1.15e-57 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132083
SMART Domains Protein: ENSMUSP00000120431
Gene: ENSMUSG00000055401

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134261
SMART Domains Protein: ENSMUSP00000123132
Gene: ENSMUSG00000055401

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 228 1.89e-85 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151127
AA Change: T221I

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000134064
Gene: ENSMUSG00000029001
AA Change: T221I

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 235 4.09e-63 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151246
SMART Domains Protein: ENSMUSP00000114571
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 231 1.43e-85 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152098
SMART Domains Protein: ENSMUSP00000121379
Gene: ENSMUSG00000055401

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153703
SMART Domains Protein: ENSMUSP00000115937
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBA 1 143 3.11e-54 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167160
SMART Domains Protein: ENSMUSP00000126551
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 252 2.24e-110 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168503
SMART Domains Protein: ENSMUSP00000130188
Gene: ENSMUSG00000055401

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172472
SMART Domains Protein: ENSMUSP00000133966
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
Pfam:FBA 68 126 3.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173352
SMART Domains Protein: ENSMUSP00000134624
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBOX 62 103 1.37e-2 SMART
FBA 121 254 3.86e-50 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. It is also a member of the NFB42 (neural F Box 42 kDa) family, similar to F-box only protein 2 and F-box only protein 6. Several alternatively spliced transcript variants encoding two distinct isoforms have been found for this gene. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik C T 4: 41,517,160 M1I probably null Het
Abca15 T C 7: 120,361,420 Y702H probably benign Het
Adgrv1 G T 13: 81,506,076 N2225K probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Alkbh5 G T 11: 60,537,995 probably benign Het
Atp5g1 A G 11: 96,075,024 M1T probably null Het
Crebrf C T 17: 26,763,403 P588S probably benign Het
Ctsr A C 13: 61,161,768 probably null Het
Cyp2c68 A G 19: 39,703,414 V355A possibly damaging Het
Ddx52 A G 11: 83,959,457 K555E possibly damaging Het
Depdc5 T A 5: 32,910,467 S410T probably damaging Het
Dhx30 A T 9: 110,085,779 I884N probably damaging Het
Dlg1 A T 16: 31,836,241 N518I possibly damaging Het
Dnah12 T A 14: 26,717,911 I506N probably damaging Het
Efcab6 A G 15: 84,032,972 L129P probably damaging Het
Erap1 A G 13: 74,660,282 N38D probably benign Het
Esf1 A G 2: 140,159,779 F383L probably benign Het
Exoc4 A G 6: 33,758,098 E550G probably damaging Het
Gal3st2b A T 1: 93,939,966 M112L possibly damaging Het
Golph3l C G 3: 95,591,834 P96A probably benign Het
Gprc6a T A 10: 51,615,260 I727F possibly damaging Het
Grin3b T C 10: 79,976,440 L479P probably damaging Het
Kdm5a C T 6: 120,374,931 H161Y probably damaging Het
Lman2 A G 13: 55,362,225 S73P probably benign Het
Map3k19 T C 1: 127,850,476 N4S possibly damaging Het
Mkln1 G A 6: 31,431,220 V161M probably damaging Het
Mmel1 C T 4: 154,895,018 H728Y probably damaging Het
Nova2 G A 7: 18,957,869 A244T unknown Het
Nrcam T A 12: 44,570,224 Y668N probably damaging Het
Oacyl G T 18: 65,726,355 G255W probably damaging Het
Olfr201 A G 16: 59,269,004 V221A probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr994 A T 2: 85,430,146 S228T probably benign Het
Omd A C 13: 49,590,367 I298L probably damaging Het
Otor A T 2: 143,078,600 D34V probably damaging Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Pwwp2a A G 11: 43,705,628 Y540C probably damaging Het
Rttn T A 18: 89,115,646 probably null Het
S1pr4 G A 10: 81,499,196 A148V probably benign Het
Scn10a C T 9: 119,613,695 V1495M possibly damaging Het
Sel1l3 T C 5: 53,200,189 K154E possibly damaging Het
Sema3a T G 5: 13,523,175 probably null Het
Slf2 T A 19: 44,960,861 N870K possibly damaging Het
Syne2 T C 12: 75,945,147 V1962A probably benign Het
Tarbp1 T A 8: 126,434,809 I1219F probably benign Het
Tet1 A C 10: 62,813,300 C173W probably damaging Het
Tnn A G 1: 160,146,071 F242S probably damaging Het
Tollip A G 7: 141,889,597 S174P probably benign Het
Tsr3 G T 17: 25,241,861 D234Y probably null Het
Vmn2r106 T C 17: 20,268,404 T578A probably benign Het
Zfp457 G T 13: 67,293,296 S309* probably null Het
Other mutations in Fbxo44
AlleleSourceChrCoordTypePredicted EffectPPH Score
trompo UTSW 4 148156004 missense probably benign
R0040:Fbxo44 UTSW 4 148158695 missense probably damaging 1.00
R0737:Fbxo44 UTSW 4 148158809 utr 5 prime probably benign
R0850:Fbxo44 UTSW 4 148156269 missense probably damaging 1.00
R0899:Fbxo44 UTSW 4 148156269 missense probably damaging 1.00
R1169:Fbxo44 UTSW 4 148155976 missense probably benign 0.01
R1423:Fbxo44 UTSW 4 148156269 missense probably damaging 1.00
R1889:Fbxo44 UTSW 4 148156269 missense probably damaging 1.00
R1895:Fbxo44 UTSW 4 148156269 missense probably damaging 1.00
R3712:Fbxo44 UTSW 4 148156004 missense probably benign
R3774:Fbxo44 UTSW 4 148156594 missense probably damaging 1.00
R3834:Fbxo44 UTSW 4 148156250 missense probably damaging 1.00
R4411:Fbxo44 UTSW 4 148153608 missense probably damaging 1.00
R4810:Fbxo44 UTSW 4 148156446 missense probably damaging 1.00
R5086:Fbxo44 UTSW 4 148156212 missense probably benign 0.00
R5108:Fbxo44 UTSW 4 148158563 missense probably damaging 1.00
R5344:Fbxo44 UTSW 4 148153573 missense probably damaging 0.98
R5423:Fbxo44 UTSW 4 148154229 missense probably benign 0.00
R5930:Fbxo44 UTSW 4 148156595 missense probably damaging 1.00
R6017:Fbxo44 UTSW 4 148158553 missense probably benign 0.17
R6498:Fbxo44 UTSW 4 148154425
R7085:Fbxo44 UTSW 4 148158743 missense probably damaging 0.98
R7142:Fbxo44 UTSW 4 148158812 missense unknown
R7374:Fbxo44 UTSW 4 148156637 missense probably benign 0.21
R7679:Fbxo44 UTSW 4 148153632 missense probably benign 0.43
X0017:Fbxo44 UTSW 4 148156223 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAGTCTTTAGGCCCAGATATTTAC -3'
(R):5'- ACATCGAGGTCAAGGACTGGTG -3'

Sequencing Primer
(F):5'- ACTTACTTTTTAGCACTGGGGATG -3'
(R):5'- ATCTCCCAGGTCTTCACAGGG -3'
Posted On2017-10-10