Incidental Mutation 'R6132:Tollip'
ID487179
Institutional Source Beutler Lab
Gene Symbol Tollip
Ensembl Gene ENSMUSG00000025139
Gene Nametoll interacting protein
Synonyms4930403G24Rik, Toll interacting protein, 4931428G15Rik
MMRRC Submission 044279-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R6132 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location141874813-141918507 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 141889597 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 174 (S174P)
Ref Sequence ENSEMBL: ENSMUSP00000051485 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001950] [ENSMUST00000055819] [ENSMUST00000130439] [ENSMUST00000151890]
Predicted Effect probably benign
Transcript: ENSMUST00000001950
AA Change: S174P

PolyPhen 2 Score 0.321 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000001950
Gene: ENSMUSG00000025139
AA Change: S174P

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
C2 54 151 1.32e-6 SMART
low complexity region 175 190 N/A INTRINSIC
low complexity region 213 225 N/A INTRINSIC
CUE 229 271 1.43e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000055819
AA Change: S174P

PolyPhen 2 Score 0.371 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000051485
Gene: ENSMUSG00000025139
AA Change: S174P

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
C2 54 151 1.32e-6 SMART
low complexity region 175 190 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000130439
AA Change: S170P
SMART Domains Protein: ENSMUSP00000117938
Gene: ENSMUSG00000025139
AA Change: S170P

DomainStartEndE-ValueType
low complexity region 24 40 N/A INTRINSIC
Pfam:C2 51 115 6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151890
AA Change: S105P

PolyPhen 2 Score 0.321 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000118336
Gene: ENSMUSG00000025139
AA Change: S105P

DomainStartEndE-ValueType
Pfam:C2 1 66 1.9e-8 PFAM
low complexity region 106 121 N/A INTRINSIC
low complexity region 144 156 N/A INTRINSIC
CUE 160 202 1.43e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211231
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-binding protein that interacts with several Toll-like receptor (TLR) signaling cascade components. The encoded protein regulates inflammatory signaling and is involved in interleukin-1 receptor trafficking and in the turnover of IL1R-associated kinase. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous null mice display normal immune cell composition but reduced cytokine production when stimulated with low concentrations of some inducers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik C T 4: 41,517,160 M1I probably null Het
Abca15 T C 7: 120,361,420 Y702H probably benign Het
Adgrv1 G T 13: 81,506,076 N2225K probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Alkbh5 G T 11: 60,537,995 probably benign Het
Atp5g1 A G 11: 96,075,024 M1T probably null Het
Crebrf C T 17: 26,763,403 P588S probably benign Het
Ctsr A C 13: 61,161,768 probably null Het
Cyp2c68 A G 19: 39,703,414 V355A possibly damaging Het
Ddx52 A G 11: 83,959,457 K555E possibly damaging Het
Depdc5 T A 5: 32,910,467 S410T probably damaging Het
Dhx30 A T 9: 110,085,779 I884N probably damaging Het
Dlg1 A T 16: 31,836,241 N518I possibly damaging Het
Dnah12 T A 14: 26,717,911 I506N probably damaging Het
Efcab6 A G 15: 84,032,972 L129P probably damaging Het
Erap1 A G 13: 74,660,282 N38D probably benign Het
Esf1 A G 2: 140,159,779 F383L probably benign Het
Exoc4 A G 6: 33,758,098 E550G probably damaging Het
Fbxo44 G A 4: 148,156,108 T221I probably benign Het
Gal3st2b A T 1: 93,939,966 M112L possibly damaging Het
Golph3l C G 3: 95,591,834 P96A probably benign Het
Gprc6a T A 10: 51,615,260 I727F possibly damaging Het
Grin3b T C 10: 79,976,440 L479P probably damaging Het
Kdm5a C T 6: 120,374,931 H161Y probably damaging Het
Lman2 A G 13: 55,362,225 S73P probably benign Het
Map3k19 T C 1: 127,850,476 N4S possibly damaging Het
Mkln1 G A 6: 31,431,220 V161M probably damaging Het
Mmel1 C T 4: 154,895,018 H728Y probably damaging Het
Nova2 G A 7: 18,957,869 A244T unknown Het
Nrcam T A 12: 44,570,224 Y668N probably damaging Het
Oacyl G T 18: 65,726,355 G255W probably damaging Het
Olfr201 A G 16: 59,269,004 V221A probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr994 A T 2: 85,430,146 S228T probably benign Het
Omd A C 13: 49,590,367 I298L probably damaging Het
Otor A T 2: 143,078,600 D34V probably damaging Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Pwwp2a A G 11: 43,705,628 Y540C probably damaging Het
Rttn T A 18: 89,115,646 probably null Het
S1pr4 G A 10: 81,499,196 A148V probably benign Het
Scn10a C T 9: 119,613,695 V1495M possibly damaging Het
Sel1l3 T C 5: 53,200,189 K154E possibly damaging Het
Sema3a T G 5: 13,523,175 probably null Het
Slf2 T A 19: 44,960,861 N870K possibly damaging Het
Syne2 T C 12: 75,945,147 V1962A probably benign Het
Tarbp1 T A 8: 126,434,809 I1219F probably benign Het
Tet1 A C 10: 62,813,300 C173W probably damaging Het
Tnn A G 1: 160,146,071 F242S probably damaging Het
Tsr3 G T 17: 25,241,861 D234Y probably null Het
Vmn2r106 T C 17: 20,268,404 T578A probably benign Het
Zfp457 G T 13: 67,293,296 S309* probably null Het
Other mutations in Tollip
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1404:Tollip UTSW 7 141884555 missense probably benign 0.00
R1404:Tollip UTSW 7 141884555 missense probably benign 0.00
R1742:Tollip UTSW 7 141892855 missense probably damaging 1.00
R2443:Tollip UTSW 7 141890823 nonsense probably null
R4092:Tollip UTSW 7 141884443 missense probably damaging 1.00
R5192:Tollip UTSW 7 141892117 missense probably damaging 1.00
R5614:Tollip UTSW 7 141892088 missense probably damaging 1.00
R6805:Tollip UTSW 7 141890845 missense probably benign 0.21
R6830:Tollip UTSW 7 141898714 start codon destroyed probably null 0.00
R7366:Tollip UTSW 7 141889597 missense probably benign 0.37
R7509:Tollip UTSW 7 141892141 missense probably benign 0.36
R7759:Tollip UTSW 7 141884539 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGATCCTCATTTAAAGCAGCC -3'
(R):5'- TTGTCTAGCTGAAGGGAGGCAG -3'

Sequencing Primer
(F):5'- GCCATGCTTACACAATTCTACAC -3'
(R):5'- CTGAAGGGAGGCAGTCTGC -3'
Posted On2017-10-10