Incidental Mutation 'R6132:Ddx52'
ID487191
Institutional Source Beutler Lab
Gene Symbol Ddx52
Ensembl Gene ENSMUSG00000020677
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 52
Synonyms2700029C06Rik, ROK1
MMRRC Submission 044279-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.922) question?
Stock #R6132 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location83942062-83963088 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83959457 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 555 (K555E)
Ref Sequence ENSEMBL: ENSMUSP00000048802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049257] [ENSMUST00000049714] [ENSMUST00000092834]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049257
AA Change: K555E

PolyPhen 2 Score 0.757 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000048802
Gene: ENSMUSG00000020677
AA Change: K555E

DomainStartEndE-ValueType
Blast:DEXDc 31 97 3e-15 BLAST
DEXDc 185 390 4.45e-51 SMART
HELICc 427 508 1.01e-31 SMART
low complexity region 544 560 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000049714
SMART Domains Protein: ENSMUSP00000059000
Gene: ENSMUSG00000034940

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
low complexity region 54 65 N/A INTRINSIC
coiled coil region 113 153 N/A INTRINSIC
Blast:EH 301 368 8e-6 BLAST
low complexity region 560 569 N/A INTRINSIC
low complexity region 644 662 N/A INTRINSIC
low complexity region 770 784 N/A INTRINSIC
low complexity region 1036 1050 N/A INTRINSIC
low complexity region 1295 1306 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092834
SMART Domains Protein: ENSMUSP00000090510
Gene: ENSMUSG00000034940

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
low complexity region 53 64 N/A INTRINSIC
coiled coil region 112 152 N/A INTRINSIC
Blast:EH 222 289 5e-6 BLAST
low complexity region 481 490 N/A INTRINSIC
low complexity region 565 583 N/A INTRINSIC
internal_repeat_1 617 755 7.57e-6 PROSPERO
internal_repeat_1 746 879 7.57e-6 PROSPERO
low complexity region 880 894 N/A INTRINSIC
low complexity region 1127 1138 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 96% (49/51)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik C T 4: 41,517,160 M1I probably null Het
Abca15 T C 7: 120,361,420 Y702H probably benign Het
Adgrv1 G T 13: 81,506,076 N2225K probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Alkbh5 G T 11: 60,537,995 probably benign Het
Atp5g1 A G 11: 96,075,024 M1T probably null Het
Crebrf C T 17: 26,763,403 P588S probably benign Het
Ctsr A C 13: 61,161,768 probably null Het
Cyp2c68 A G 19: 39,703,414 V355A possibly damaging Het
Depdc5 T A 5: 32,910,467 S410T probably damaging Het
Dhx30 A T 9: 110,085,779 I884N probably damaging Het
Dlg1 A T 16: 31,836,241 N518I possibly damaging Het
Dnah12 T A 14: 26,717,911 I506N probably damaging Het
Efcab6 A G 15: 84,032,972 L129P probably damaging Het
Erap1 A G 13: 74,660,282 N38D probably benign Het
Esf1 A G 2: 140,159,779 F383L probably benign Het
Exoc4 A G 6: 33,758,098 E550G probably damaging Het
Fbxo44 G A 4: 148,156,108 T221I probably benign Het
Gal3st2b A T 1: 93,939,966 M112L possibly damaging Het
Golph3l C G 3: 95,591,834 P96A probably benign Het
Gprc6a T A 10: 51,615,260 I727F possibly damaging Het
Grin3b T C 10: 79,976,440 L479P probably damaging Het
Kdm5a C T 6: 120,374,931 H161Y probably damaging Het
Lman2 A G 13: 55,362,225 S73P probably benign Het
Map3k19 T C 1: 127,850,476 N4S possibly damaging Het
Mkln1 G A 6: 31,431,220 V161M probably damaging Het
Mmel1 C T 4: 154,895,018 H728Y probably damaging Het
Nova2 G A 7: 18,957,869 A244T unknown Het
Nrcam T A 12: 44,570,224 Y668N probably damaging Het
Oacyl G T 18: 65,726,355 G255W probably damaging Het
Olfr201 A G 16: 59,269,004 V221A probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr994 A T 2: 85,430,146 S228T probably benign Het
Omd A C 13: 49,590,367 I298L probably damaging Het
Otor A T 2: 143,078,600 D34V probably damaging Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Pwwp2a A G 11: 43,705,628 Y540C probably damaging Het
Rttn T A 18: 89,115,646 probably null Het
S1pr4 G A 10: 81,499,196 A148V probably benign Het
Scn10a C T 9: 119,613,695 V1495M possibly damaging Het
Sel1l3 T C 5: 53,200,189 K154E possibly damaging Het
Sema3a T G 5: 13,523,175 probably null Het
Slf2 T A 19: 44,960,861 N870K possibly damaging Het
Syne2 T C 12: 75,945,147 V1962A probably benign Het
Tarbp1 T A 8: 126,434,809 I1219F probably benign Het
Tet1 A C 10: 62,813,300 C173W probably damaging Het
Tnn A G 1: 160,146,071 F242S probably damaging Het
Tollip A G 7: 141,889,597 S174P probably benign Het
Tsr3 G T 17: 25,241,861 D234Y probably null Het
Vmn2r106 T C 17: 20,268,404 T578A probably benign Het
Zfp457 G T 13: 67,293,296 S309* probably null Het
Other mutations in Ddx52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02271:Ddx52 APN 11 83952231 missense probably damaging 0.99
IGL02309:Ddx52 APN 11 83948478 missense probably damaging 1.00
R0306:Ddx52 UTSW 11 83944648 missense probably benign 0.22
R1636:Ddx52 UTSW 11 83955343 missense probably damaging 1.00
R1641:Ddx52 UTSW 11 83943443 critical splice donor site probably null
R1803:Ddx52 UTSW 11 83946132 missense probably damaging 0.98
R1834:Ddx52 UTSW 11 83959497 missense probably benign 0.03
R2037:Ddx52 UTSW 11 83944606 missense probably benign
R4592:Ddx52 UTSW 11 83957480 missense probably damaging 1.00
R4716:Ddx52 UTSW 11 83955205 critical splice donor site probably null
R5774:Ddx52 UTSW 11 83946134 missense probably damaging 1.00
R5807:Ddx52 UTSW 11 83949682 missense probably benign 0.00
R5972:Ddx52 UTSW 11 83953225 critical splice acceptor site probably null
R6525:Ddx52 UTSW 11 83953319 critical splice donor site probably null
R6747:Ddx52 UTSW 11 83955302 missense probably damaging 1.00
R7250:Ddx52 UTSW 11 83944566 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAGAATGTCTTTAATCACAGCC -3'
(R):5'- CTCCCAAATCAAAGGCATTCTGAG -3'

Sequencing Primer
(F):5'- AGTGCTGTCAGCTGATCT -3'
(R):5'- CCATACCCTATAGTGGATTACCTATG -3'
Posted On2017-10-10