Incidental Mutation 'R6132:Atp5g1'
ID487192
Institutional Source Beutler Lab
Gene Symbol Atp5g1
Ensembl Gene ENSMUSG00000006057
Gene NameATP synthase, H+ transporting, mitochondrial F0 complex, subunit C1 (subunit 9)
Synonyms
MMRRC Submission 044279-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R6132 (G1)
Quality Score93.0077
Status Validated
Chromosome11
Chromosomal Location96068852-96075670 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to G at 96075024 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1 (M1T)
Ref Sequence ENSEMBL: ENSMUSP00000137633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090541] [ENSMUST00000107684] [ENSMUST00000107686] [ENSMUST00000178611]
Predicted Effect probably null
Transcript: ENSMUST00000090541
AA Change: M1T

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000088029
Gene: ENSMUSG00000006057
AA Change: M1T

DomainStartEndE-ValueType
Pfam:ATP-synt_C 67 135 5.1e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107684
AA Change: M1T

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103312
Gene: ENSMUSG00000006057
AA Change: M1T

DomainStartEndE-ValueType
Pfam:ATP-synt_C 67 135 5.1e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107686
AA Change: M1T

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103314
Gene: ENSMUSG00000006057
AA Change: M1T

DomainStartEndE-ValueType
Pfam:ATP-synt_C 67 135 5.1e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000178611
AA Change: M1T

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000137633
Gene: ENSMUSG00000006057
AA Change: M1T

DomainStartEndE-ValueType
Pfam:ATP-synt_C 67 135 5.1e-19 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and a single representative of the other 3. The proton channel seems to have nine subunits (a, b, c, d, e, f, g, F6 and 8). This gene is one of three genes that encode subunit c of the proton channel. Each of the three genes have distinct mitochondrial import sequences but encode the identical mature protein. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik C T 4: 41,517,160 M1I probably null Het
Abca15 T C 7: 120,361,420 Y702H probably benign Het
Adgrv1 G T 13: 81,506,076 N2225K probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Alkbh5 G T 11: 60,537,995 probably benign Het
Crebrf C T 17: 26,763,403 P588S probably benign Het
Ctsr A C 13: 61,161,768 probably null Het
Cyp2c68 A G 19: 39,703,414 V355A possibly damaging Het
Ddx52 A G 11: 83,959,457 K555E possibly damaging Het
Depdc5 T A 5: 32,910,467 S410T probably damaging Het
Dhx30 A T 9: 110,085,779 I884N probably damaging Het
Dlg1 A T 16: 31,836,241 N518I possibly damaging Het
Dnah12 T A 14: 26,717,911 I506N probably damaging Het
Efcab6 A G 15: 84,032,972 L129P probably damaging Het
Erap1 A G 13: 74,660,282 N38D probably benign Het
Esf1 A G 2: 140,159,779 F383L probably benign Het
Exoc4 A G 6: 33,758,098 E550G probably damaging Het
Fbxo44 G A 4: 148,156,108 T221I probably benign Het
Gal3st2b A T 1: 93,939,966 M112L possibly damaging Het
Golph3l C G 3: 95,591,834 P96A probably benign Het
Gprc6a T A 10: 51,615,260 I727F possibly damaging Het
Grin3b T C 10: 79,976,440 L479P probably damaging Het
Kdm5a C T 6: 120,374,931 H161Y probably damaging Het
Lman2 A G 13: 55,362,225 S73P probably benign Het
Map3k19 T C 1: 127,850,476 N4S possibly damaging Het
Mkln1 G A 6: 31,431,220 V161M probably damaging Het
Mmel1 C T 4: 154,895,018 H728Y probably damaging Het
Nova2 G A 7: 18,957,869 A244T unknown Het
Nrcam T A 12: 44,570,224 Y668N probably damaging Het
Oacyl G T 18: 65,726,355 G255W probably damaging Het
Olfr201 A G 16: 59,269,004 V221A probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr994 A T 2: 85,430,146 S228T probably benign Het
Omd A C 13: 49,590,367 I298L probably damaging Het
Otor A T 2: 143,078,600 D34V probably damaging Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Pwwp2a A G 11: 43,705,628 Y540C probably damaging Het
Rttn T A 18: 89,115,646 probably null Het
S1pr4 G A 10: 81,499,196 A148V probably benign Het
Scn10a C T 9: 119,613,695 V1495M possibly damaging Het
Sel1l3 T C 5: 53,200,189 K154E possibly damaging Het
Sema3a T G 5: 13,523,175 probably null Het
Slf2 T A 19: 44,960,861 N870K possibly damaging Het
Syne2 T C 12: 75,945,147 V1962A probably benign Het
Tarbp1 T A 8: 126,434,809 I1219F probably benign Het
Tet1 A C 10: 62,813,300 C173W probably damaging Het
Tnn A G 1: 160,146,071 F242S probably damaging Het
Tollip A G 7: 141,889,597 S174P probably benign Het
Tsr3 G T 17: 25,241,861 D234Y probably null Het
Vmn2r106 T C 17: 20,268,404 T578A probably benign Het
Zfp457 G T 13: 67,293,296 S309* probably null Het
Other mutations in Atp5g1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R6643:Atp5g1 UTSW 11 96074028 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGGTTACCTGCAACAGCTCC -3'
(R):5'- GGAGACCATTCCTTTTCGCAAC -3'

Sequencing Primer
(F):5'- GGTTACCTGCAACAGCTCCTATAC -3'
(R):5'- GGTTGCCAGTATAAGCAG -3'
Posted On2017-10-10