Incidental Mutation 'R6132:Crebrf'
ID487207
Institutional Source Beutler Lab
Gene Symbol Crebrf
Ensembl Gene ENSMUSG00000048249
Gene NameCREB3 regulatory factor
SynonymsA930001N09Rik
MMRRC Submission 044279-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.417) question?
Stock #R6132 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location26715650-26776635 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 26763403 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 588 (P588S)
Ref Sequence ENSEMBL: ENSMUSP00000059102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062519] [ENSMUST00000142539] [ENSMUST00000151681]
Predicted Effect probably benign
Transcript: ENSMUST00000062519
AA Change: P588S

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000059102
Gene: ENSMUSG00000048249
AA Change: P588S

DomainStartEndE-ValueType
low complexity region 317 330 N/A INTRINSIC
low complexity region 356 407 N/A INTRINSIC
Blast:BRLZ 520 584 3e-35 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000142539
AA Change: P580S

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000114274
Gene: ENSMUSG00000048249
AA Change: P580S

DomainStartEndE-ValueType
low complexity region 309 322 N/A INTRINSIC
low complexity region 348 399 N/A INTRINSIC
Blast:BRLZ 512 576 3e-35 BLAST
low complexity region 617 630 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151681
SMART Domains Protein: ENSMUSP00000119186
Gene: ENSMUSG00000048249

DomainStartEndE-ValueType
Blast:BRLZ 100 137 2e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176845
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 96% (49/51)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired social recognition, increased vertical and horizontal activity, abnormal maternal nurturing, decreased prolactin and corticosterone serum levels, and abnormal mammary gland growth during lactation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik C T 4: 41,517,160 M1I probably null Het
Abca15 T C 7: 120,361,420 Y702H probably benign Het
Adgrv1 G T 13: 81,506,076 N2225K probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Alkbh5 G T 11: 60,537,995 probably benign Het
Atp5g1 A G 11: 96,075,024 M1T probably null Het
Ctsr A C 13: 61,161,768 probably null Het
Cyp2c68 A G 19: 39,703,414 V355A possibly damaging Het
Ddx52 A G 11: 83,959,457 K555E possibly damaging Het
Depdc5 T A 5: 32,910,467 S410T probably damaging Het
Dhx30 A T 9: 110,085,779 I884N probably damaging Het
Dlg1 A T 16: 31,836,241 N518I possibly damaging Het
Dnah12 T A 14: 26,717,911 I506N probably damaging Het
Efcab6 A G 15: 84,032,972 L129P probably damaging Het
Erap1 A G 13: 74,660,282 N38D probably benign Het
Esf1 A G 2: 140,159,779 F383L probably benign Het
Exoc4 A G 6: 33,758,098 E550G probably damaging Het
Fbxo44 G A 4: 148,156,108 T221I probably benign Het
Gal3st2b A T 1: 93,939,966 M112L possibly damaging Het
Golph3l C G 3: 95,591,834 P96A probably benign Het
Gprc6a T A 10: 51,615,260 I727F possibly damaging Het
Grin3b T C 10: 79,976,440 L479P probably damaging Het
Kdm5a C T 6: 120,374,931 H161Y probably damaging Het
Lman2 A G 13: 55,362,225 S73P probably benign Het
Map3k19 T C 1: 127,850,476 N4S possibly damaging Het
Mkln1 G A 6: 31,431,220 V161M probably damaging Het
Mmel1 C T 4: 154,895,018 H728Y probably damaging Het
Nova2 G A 7: 18,957,869 A244T unknown Het
Nrcam T A 12: 44,570,224 Y668N probably damaging Het
Oacyl G T 18: 65,726,355 G255W probably damaging Het
Olfr201 A G 16: 59,269,004 V221A probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr994 A T 2: 85,430,146 S228T probably benign Het
Omd A C 13: 49,590,367 I298L probably damaging Het
Otor A T 2: 143,078,600 D34V probably damaging Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Pwwp2a A G 11: 43,705,628 Y540C probably damaging Het
Rttn T A 18: 89,115,646 probably null Het
S1pr4 G A 10: 81,499,196 A148V probably benign Het
Scn10a C T 9: 119,613,695 V1495M possibly damaging Het
Sel1l3 T C 5: 53,200,189 K154E possibly damaging Het
Sema3a T G 5: 13,523,175 probably null Het
Slf2 T A 19: 44,960,861 N870K possibly damaging Het
Syne2 T C 12: 75,945,147 V1962A probably benign Het
Tarbp1 T A 8: 126,434,809 I1219F probably benign Het
Tet1 A C 10: 62,813,300 C173W probably damaging Het
Tnn A G 1: 160,146,071 F242S probably damaging Het
Tollip A G 7: 141,889,597 S174P probably benign Het
Tsr3 G T 17: 25,241,861 D234Y probably null Het
Vmn2r106 T C 17: 20,268,404 T578A probably benign Het
Zfp457 G T 13: 67,293,296 S309* probably null Het
Other mutations in Crebrf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Crebrf APN 17 26743093 missense probably damaging 1.00
IGL03106:Crebrf APN 17 26771319 missense probably damaging 1.00
R0046:Crebrf UTSW 17 26763334 missense probably damaging 1.00
R0046:Crebrf UTSW 17 26763334 missense probably damaging 1.00
R0254:Crebrf UTSW 17 26739594 missense probably benign 0.01
R0448:Crebrf UTSW 17 26743102 missense probably benign 0.42
R1268:Crebrf UTSW 17 26739596 frame shift probably null
R1857:Crebrf UTSW 17 26742963 missense probably benign 0.00
R1858:Crebrf UTSW 17 26742963 missense probably benign 0.00
R1937:Crebrf UTSW 17 26742468 missense probably damaging 1.00
R2005:Crebrf UTSW 17 26742883 missense possibly damaging 0.53
R2006:Crebrf UTSW 17 26742883 missense possibly damaging 0.53
R2031:Crebrf UTSW 17 26742921 missense probably damaging 0.97
R2323:Crebrf UTSW 17 26763607 unclassified probably benign
R2352:Crebrf UTSW 17 26742346 missense probably damaging 1.00
R4510:Crebrf UTSW 17 26742964 missense probably benign
R4511:Crebrf UTSW 17 26742964 missense probably benign
R4585:Crebrf UTSW 17 26762255 missense probably damaging 1.00
R4642:Crebrf UTSW 17 26743061 missense probably benign 0.23
R4896:Crebrf UTSW 17 26742420 missense possibly damaging 0.75
R5227:Crebrf UTSW 17 26759765 missense probably damaging 1.00
R5377:Crebrf UTSW 17 26759865 missense probably damaging 0.99
R5443:Crebrf UTSW 17 26742354 missense probably damaging 1.00
R5540:Crebrf UTSW 17 26742097 missense possibly damaging 0.90
R6017:Crebrf UTSW 17 26757849 missense probably benign 0.04
R7464:Crebrf UTSW 17 26763487 missense unknown
Predicted Primers PCR Primer
(F):5'- TGGCATTTCCCCAGATTCTG -3'
(R):5'- CTGAGGAAGATAAATCCCTACCGAG -3'

Sequencing Primer
(F):5'- GAAATTCATCCCAAGGCTTTGTGC -3'
(R):5'- CGAGAGGTGGGGGCAGATG -3'
Posted On2017-10-10