Incidental Mutation 'R6132:Slf2'
ID487212
Institutional Source Beutler Lab
Gene Symbol Slf2
Ensembl Gene ENSMUSG00000036097
Gene NameSMC5-SMC6 complex localization factor 2
SynonymsFam178a, 6030443O07Rik
MMRRC Submission 044279-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.894) question?
Stock #R6132 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location44931119-44983787 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44960861 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 870 (N870K)
Ref Sequence ENSEMBL: ENSMUSP00000093758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096053]
Predicted Effect possibly damaging
Transcript: ENSMUST00000096053
AA Change: N870K

PolyPhen 2 Score 0.601 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000093758
Gene: ENSMUSG00000036097
AA Change: N870K

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
low complexity region 91 103 N/A INTRINSIC
low complexity region 211 226 N/A INTRINSIC
coiled coil region 239 266 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 549 568 N/A INTRINSIC
low complexity region 572 582 N/A INTRINSIC
low complexity region 601 616 N/A INTRINSIC
Pfam:FAM178 647 1021 3.9e-146 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 96% (49/51)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik C T 4: 41,517,160 M1I probably null Het
Abca15 T C 7: 120,361,420 Y702H probably benign Het
Adgrv1 G T 13: 81,506,076 N2225K probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Alkbh5 G T 11: 60,537,995 probably benign Het
Atp5g1 A G 11: 96,075,024 M1T probably null Het
Crebrf C T 17: 26,763,403 P588S probably benign Het
Ctsr A C 13: 61,161,768 probably null Het
Cyp2c68 A G 19: 39,703,414 V355A possibly damaging Het
Ddx52 A G 11: 83,959,457 K555E possibly damaging Het
Depdc5 T A 5: 32,910,467 S410T probably damaging Het
Dhx30 A T 9: 110,085,779 I884N probably damaging Het
Dlg1 A T 16: 31,836,241 N518I possibly damaging Het
Dnah12 T A 14: 26,717,911 I506N probably damaging Het
Efcab6 A G 15: 84,032,972 L129P probably damaging Het
Erap1 A G 13: 74,660,282 N38D probably benign Het
Esf1 A G 2: 140,159,779 F383L probably benign Het
Exoc4 A G 6: 33,758,098 E550G probably damaging Het
Fbxo44 G A 4: 148,156,108 T221I probably benign Het
Gal3st2b A T 1: 93,939,966 M112L possibly damaging Het
Golph3l C G 3: 95,591,834 P96A probably benign Het
Gprc6a T A 10: 51,615,260 I727F possibly damaging Het
Grin3b T C 10: 79,976,440 L479P probably damaging Het
Kdm5a C T 6: 120,374,931 H161Y probably damaging Het
Lman2 A G 13: 55,362,225 S73P probably benign Het
Map3k19 T C 1: 127,850,476 N4S possibly damaging Het
Mkln1 G A 6: 31,431,220 V161M probably damaging Het
Mmel1 C T 4: 154,895,018 H728Y probably damaging Het
Nova2 G A 7: 18,957,869 A244T unknown Het
Nrcam T A 12: 44,570,224 Y668N probably damaging Het
Oacyl G T 18: 65,726,355 G255W probably damaging Het
Olfr201 A G 16: 59,269,004 V221A probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr994 A T 2: 85,430,146 S228T probably benign Het
Omd A C 13: 49,590,367 I298L probably damaging Het
Otor A T 2: 143,078,600 D34V probably damaging Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Pwwp2a A G 11: 43,705,628 Y540C probably damaging Het
Rttn T A 18: 89,115,646 probably null Het
S1pr4 G A 10: 81,499,196 A148V probably benign Het
Scn10a C T 9: 119,613,695 V1495M possibly damaging Het
Sel1l3 T C 5: 53,200,189 K154E possibly damaging Het
Sema3a T G 5: 13,523,175 probably null Het
Syne2 T C 12: 75,945,147 V1962A probably benign Het
Tarbp1 T A 8: 126,434,809 I1219F probably benign Het
Tet1 A C 10: 62,813,300 C173W probably damaging Het
Tnn A G 1: 160,146,071 F242S probably damaging Het
Tollip A G 7: 141,889,597 S174P probably benign Het
Tsr3 G T 17: 25,241,861 D234Y probably null Het
Vmn2r106 T C 17: 20,268,404 T578A probably benign Het
Zfp457 G T 13: 67,293,296 S309* probably null Het
Other mutations in Slf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01734:Slf2 APN 19 44973267 critical splice donor site probably null
IGL01904:Slf2 APN 19 44949141 critical splice donor site probably null
IGL02429:Slf2 APN 19 44941728 missense probably benign
IGL02899:Slf2 APN 19 44942020 missense probably benign 0.26
R0060:Slf2 UTSW 19 44948004 missense probably damaging 1.00
R0731:Slf2 UTSW 19 44975726 splice site probably benign
R1158:Slf2 UTSW 19 44931416 missense probably damaging 0.99
R1590:Slf2 UTSW 19 44942073 nonsense probably null
R1608:Slf2 UTSW 19 44949001 missense probably benign 0.08
R1823:Slf2 UTSW 19 44935248 missense possibly damaging 0.86
R2511:Slf2 UTSW 19 44941606 missense possibly damaging 0.86
R3040:Slf2 UTSW 19 44980569 missense probably damaging 0.99
R3236:Slf2 UTSW 19 44942334 missense probably benign 0.33
R3237:Slf2 UTSW 19 44942334 missense probably benign 0.33
R3552:Slf2 UTSW 19 44934951 nonsense probably null
R3754:Slf2 UTSW 19 44973237 missense probably benign
R4683:Slf2 UTSW 19 44935481 missense probably benign 0.22
R4757:Slf2 UTSW 19 44935058 missense probably benign
R4782:Slf2 UTSW 19 44934925 splice site probably null
R4914:Slf2 UTSW 19 44971661 missense probably damaging 0.96
R4915:Slf2 UTSW 19 44971661 missense probably damaging 0.96
R4916:Slf2 UTSW 19 44971661 missense probably damaging 0.96
R4917:Slf2 UTSW 19 44971661 missense probably damaging 0.96
R4918:Slf2 UTSW 19 44971661 missense probably damaging 0.96
R5069:Slf2 UTSW 19 44935253 missense possibly damaging 0.94
R5092:Slf2 UTSW 19 44952084 missense probably benign 0.14
R5215:Slf2 UTSW 19 44948037 missense probably damaging 0.99
R5276:Slf2 UTSW 19 44935161 missense possibly damaging 0.84
R5656:Slf2 UTSW 19 44973235 missense probably benign 0.13
R6358:Slf2 UTSW 19 44935425 missense probably benign 0.34
R6481:Slf2 UTSW 19 44973164 missense probably benign 0.01
R6809:Slf2 UTSW 19 44943468 missense probably damaging 0.98
R7263:Slf2 UTSW 19 44938424 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACTACTCAAGGTGGTTTTGTGAAAGAG -3'
(R):5'- GATGGTAACTTTTACATTAGGGCAG -3'

Sequencing Primer
(F):5'- AGGTGGTTTTGTGAAAGAGTGATTTG -3'
(R):5'- AGCCCAGTTTTGTGGCATAC -3'
Posted On2017-10-10