Incidental Mutation 'R6133:Zcchc2'
ID487217
Institutional Source Beutler Lab
Gene Symbol Zcchc2
Ensembl Gene ENSMUSG00000038866
Gene Namezinc finger, CCHC domain containing 2
Synonyms9930114B20Rik
MMRRC Submission 044280-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock #R6133 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location105990406-106034074 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 106019879 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 117 (K117N)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118196] [ENSMUST00000119166] [ENSMUST00000131830]
Predicted Effect probably damaging
Transcript: ENSMUST00000118196
AA Change: K501N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113974
Gene: ENSMUSG00000038866
AA Change: K501N

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
low complexity region 34 67 N/A INTRINSIC
low complexity region 69 87 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
SCOP:d1gd5a_ 347 451 5e-7 SMART
low complexity region 480 491 N/A INTRINSIC
low complexity region 567 581 N/A INTRINSIC
low complexity region 624 634 N/A INTRINSIC
low complexity region 640 659 N/A INTRINSIC
low complexity region 777 795 N/A INTRINSIC
low complexity region 899 918 N/A INTRINSIC
low complexity region 998 1010 N/A INTRINSIC
low complexity region 1020 1031 N/A INTRINSIC
ZnF_C2HC 1120 1136 1.12e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119166
AA Change: K501N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113128
Gene: ENSMUSG00000038866
AA Change: K501N

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
low complexity region 34 67 N/A INTRINSIC
low complexity region 69 87 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
SCOP:d1gd5a_ 347 451 5e-7 SMART
low complexity region 480 491 N/A INTRINSIC
low complexity region 567 581 N/A INTRINSIC
low complexity region 624 634 N/A INTRINSIC
low complexity region 640 659 N/A INTRINSIC
low complexity region 777 795 N/A INTRINSIC
low complexity region 899 918 N/A INTRINSIC
low complexity region 998 1010 N/A INTRINSIC
low complexity region 1020 1031 N/A INTRINSIC
ZnF_C2HC 1120 1136 1.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131830
Predicted Effect probably damaging
Transcript: ENSMUST00000186983
AA Change: K98N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000188954
AA Change: K117N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 A G 8: 88,325,439 T912A possibly damaging Het
Akap12 G T 10: 4,355,178 G663C probably benign Het
Akap2 C T 4: 57,855,516 Q525* probably null Het
Ankhd1 T C 18: 36,625,126 S958P possibly damaging Het
Cmtm2a T C 8: 104,292,730 I76V probably benign Het
Cpxm2 G A 7: 132,128,453 P146S probably damaging Het
Cubn A G 2: 13,308,618 V3047A probably benign Het
Dgkd T A 1: 87,938,240 V198E possibly damaging Het
Dnah3 A T 7: 120,086,246 M181K probably benign Het
Dnah7a T C 1: 53,419,655 T3775A probably benign Het
Dsg2 A G 18: 20,590,089 I391V probably benign Het
Ebi3 T A 17: 55,954,311 V69E probably benign Het
Fn1 T C 1: 71,597,727 T1998A probably damaging Het
Frmpd1 T A 4: 45,284,915 H1245Q probably benign Het
Gm7145 T A 1: 117,985,888 C167S probably damaging Het
Hydin C T 8: 110,601,276 T4805I probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnma1 C T 14: 24,003,868 M21I probably damaging Het
Lrfn5 A G 12: 61,843,788 D621G probably benign Het
Lrrc15 C T 16: 30,274,236 G95D probably benign Het
Mex3d A G 10: 80,386,786 L212P probably damaging Het
Mmel1 C T 4: 154,895,018 H728Y probably damaging Het
Naip1 A G 13: 100,444,643 V32A probably benign Het
Nsl1 T C 1: 191,071,206 L158P probably damaging Het
Olfr638 A T 7: 104,003,325 T17S possibly damaging Het
Olfr771 G A 10: 129,160,883 L34F possibly damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Pcdh15 A T 10: 74,645,973 probably null Het
Pramef20 T C 4: 144,377,777 R53G possibly damaging Het
Ptpn1 T C 2: 167,967,796 V108A possibly damaging Het
Rad9b T C 5: 122,339,768 N182D possibly damaging Het
Rp1l1 C T 14: 64,030,096 P1044S probably damaging Het
Scn2a G A 2: 65,743,104 V1433I probably benign Het
Ssrp1 T G 2: 85,045,339 probably benign Het
Suco T A 1: 161,835,183 K560* probably null Het
Tbx3 T C 5: 119,680,953 V531A probably benign Het
Tmem30c T C 16: 57,277,737 Y107C probably damaging Het
Topbp1 T A 9: 103,311,764 probably null Het
Trpm5 A T 7: 143,088,951 D86E probably damaging Het
Urb2 C T 8: 124,028,561 Q336* probably null Het
Vmn2r43 A G 7: 8,244,971 F731S probably damaging Het
Xkr9 A G 1: 13,684,135 T118A probably benign Het
Zfp52 T C 17: 21,560,471 Y194H probably damaging Het
Zfp763 C T 17: 33,018,701 C490Y possibly damaging Het
Zmynd19 G T 2: 24,958,119 R148L possibly damaging Het
Other mutations in Zcchc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Zcchc2 APN 1 106030263 missense probably benign 0.25
IGL01339:Zcchc2 APN 1 106029775 missense probably damaging 1.00
IGL01981:Zcchc2 APN 1 106027499 missense probably damaging 1.00
IGL02172:Zcchc2 APN 1 106000934 missense probably benign 0.00
IGL02864:Zcchc2 APN 1 106016084 missense probably damaging 1.00
IGL02993:Zcchc2 APN 1 106030168 missense probably damaging 0.99
IGL03163:Zcchc2 APN 1 106031111 missense probably damaging 1.00
P0042:Zcchc2 UTSW 1 106030997 missense possibly damaging 0.95
R0200:Zcchc2 UTSW 1 106004123 missense probably damaging 1.00
R0477:Zcchc2 UTSW 1 106030270 missense possibly damaging 0.91
R0501:Zcchc2 UTSW 1 106016091 missense possibly damaging 0.88
R0689:Zcchc2 UTSW 1 106030504 nonsense probably null
R1799:Zcchc2 UTSW 1 106030287 missense probably benign 0.00
R2016:Zcchc2 UTSW 1 106004121 unclassified probably null
R2153:Zcchc2 UTSW 1 106021723 splice site probably null
R2175:Zcchc2 UTSW 1 106027423 missense probably damaging 1.00
R2999:Zcchc2 UTSW 1 106030024 missense probably benign 0.00
R3113:Zcchc2 UTSW 1 105991022 missense unknown
R4571:Zcchc2 UTSW 1 106031257 missense possibly damaging 0.66
R4670:Zcchc2 UTSW 1 105990266 unclassified probably benign
R5067:Zcchc2 UTSW 1 106030964 missense probably damaging 1.00
R5423:Zcchc2 UTSW 1 106030700 missense probably damaging 1.00
R5499:Zcchc2 UTSW 1 106030592 missense possibly damaging 0.71
R5522:Zcchc2 UTSW 1 106023696 missense probably benign 0.00
R5526:Zcchc2 UTSW 1 106030254 nonsense probably null
R5571:Zcchc2 UTSW 1 106023672 missense probably benign
R5599:Zcchc2 UTSW 1 106032150 missense probably damaging 1.00
R6191:Zcchc2 UTSW 1 105990170 unclassified probably benign
R6194:Zcchc2 UTSW 1 105991117 missense probably damaging 1.00
R6246:Zcchc2 UTSW 1 106030066 missense possibly damaging 0.75
R7089:Zcchc2 UTSW 1 106030481 missense probably damaging 1.00
R7626:Zcchc2 UTSW 1 106001012 missense possibly damaging 0.69
R7749:Zcchc2 UTSW 1 106018273 missense probably damaging 1.00
R7781:Zcchc2 UTSW 1 106004165 missense probably damaging 1.00
R7792:Zcchc2 UTSW 1 106018252 missense probably damaging 0.99
RF022:Zcchc2 UTSW 1 106011742 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- AAGATTGGTGTGCACATTTGAG -3'
(R):5'- GGCTGCCACAAAAGAACTTC -3'

Sequencing Primer
(F):5'- GCCTGGACCATATAGTAGACCTTG -3'
(R):5'- GGAAACAGCACGCACGGC -3'
Posted On2017-10-10