Incidental Mutation 'R6133:Gm7145'
ID487218
Institutional Source Beutler Lab
Gene Symbol Gm7145
Ensembl Gene ENSMUSG00000100617
Gene Namepredicted gene 7145
Synonyms
MMRRC Submission 044280-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.261) question?
Stock #R6133 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location117965939-117986884 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 117985888 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 167 (C167S)
Ref Sequence ENSEMBL: ENSMUSP00000140916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000185381]
Predicted Effect probably damaging
Transcript: ENSMUST00000185381
AA Change: C167S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140916
Gene: ENSMUSG00000100617
AA Change: C167S

DomainStartEndE-ValueType
KRAB 8 68 4.4e-36 SMART
ZnF_C2H2 109 131 3.6e-6 SMART
ZnF_C2H2 137 159 3.4e-5 SMART
ZnF_C2H2 165 187 1.7e-6 SMART
ZnF_C2H2 193 215 1e-7 SMART
ZnF_C2H2 221 243 2e-5 SMART
ZnF_C2H2 249 271 2.1e-7 SMART
ZnF_C2H2 277 299 9.3e-5 SMART
ZnF_C2H2 305 327 3.4e-4 SMART
ZnF_C2H2 333 355 3.2e-7 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 A G 8: 88,325,439 T912A possibly damaging Het
Akap12 G T 10: 4,355,178 G663C probably benign Het
Akap2 C T 4: 57,855,516 Q525* probably null Het
Ankhd1 T C 18: 36,625,126 S958P possibly damaging Het
Cmtm2a T C 8: 104,292,730 I76V probably benign Het
Cpxm2 G A 7: 132,128,453 P146S probably damaging Het
Cubn A G 2: 13,308,618 V3047A probably benign Het
Dgkd T A 1: 87,938,240 V198E possibly damaging Het
Dnah3 A T 7: 120,086,246 M181K probably benign Het
Dnah7a T C 1: 53,419,655 T3775A probably benign Het
Dsg2 A G 18: 20,590,089 I391V probably benign Het
Ebi3 T A 17: 55,954,311 V69E probably benign Het
Fn1 T C 1: 71,597,727 T1998A probably damaging Het
Frmpd1 T A 4: 45,284,915 H1245Q probably benign Het
Hydin C T 8: 110,601,276 T4805I probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnma1 C T 14: 24,003,868 M21I probably damaging Het
Lrfn5 A G 12: 61,843,788 D621G probably benign Het
Lrrc15 C T 16: 30,274,236 G95D probably benign Het
Mex3d A G 10: 80,386,786 L212P probably damaging Het
Mmel1 C T 4: 154,895,018 H728Y probably damaging Het
Naip1 A G 13: 100,444,643 V32A probably benign Het
Nsl1 T C 1: 191,071,206 L158P probably damaging Het
Olfr638 A T 7: 104,003,325 T17S possibly damaging Het
Olfr771 G A 10: 129,160,883 L34F possibly damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Pcdh15 A T 10: 74,645,973 probably null Het
Pramef20 T C 4: 144,377,777 R53G possibly damaging Het
Ptpn1 T C 2: 167,967,796 V108A possibly damaging Het
Rad9b T C 5: 122,339,768 N182D possibly damaging Het
Rp1l1 C T 14: 64,030,096 P1044S probably damaging Het
Scn2a G A 2: 65,743,104 V1433I probably benign Het
Ssrp1 T G 2: 85,045,339 probably benign Het
Suco T A 1: 161,835,183 K560* probably null Het
Tbx3 T C 5: 119,680,953 V531A probably benign Het
Tmem30c T C 16: 57,277,737 Y107C probably damaging Het
Topbp1 T A 9: 103,311,764 probably null Het
Trpm5 A T 7: 143,088,951 D86E probably damaging Het
Urb2 C T 8: 124,028,561 Q336* probably null Het
Vmn2r43 A G 7: 8,244,971 F731S probably damaging Het
Xkr9 A G 1: 13,684,135 T118A probably benign Het
Zcchc2 A C 1: 106,019,879 K117N probably damaging Het
Zfp52 T C 17: 21,560,471 Y194H probably damaging Het
Zfp763 C T 17: 33,018,701 C490Y possibly damaging Het
Zmynd19 G T 2: 24,958,119 R148L possibly damaging Het
Other mutations in Gm7145
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03027:Gm7145 APN 1 117967687 missense probably benign 0.00
R6244:Gm7145 UTSW 1 117986140 missense probably damaging 1.00
R6381:Gm7145 UTSW 1 117985939 nonsense probably null
R6578:Gm7145 UTSW 1 117985795 missense probably damaging 0.98
R6853:Gm7145 UTSW 1 117986144 missense possibly damaging 0.95
R6913:Gm7145 UTSW 1 117985981 missense probably damaging 1.00
R7159:Gm7145 UTSW 1 117985831 missense probably benign 0.01
R7196:Gm7145 UTSW 1 117986061 missense possibly damaging 0.81
R7313:Gm7145 UTSW 1 117986202 missense probably damaging 1.00
R7343:Gm7145 UTSW 1 117986112 missense probably damaging 1.00
R7369:Gm7145 UTSW 1 117986108 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAAGCTCCAGATACTCTTCCTG -3'
(R):5'- GTCTCCAGTATGTAATCTGTGGTGAAC -3'

Sequencing Primer
(F):5'- CACTACAGAATTTCTACTCGAGTGAC -3'
(R):5'- AATCTGTGGTGAACTTTAAGATGTG -3'
Posted On2017-10-10