Incidental Mutation 'R6133:Ptpn1'
ID487224
Institutional Source Beutler Lab
Gene Symbol Ptpn1
Ensembl Gene ENSMUSG00000027540
Gene Nameprotein tyrosine phosphatase, non-receptor type 1
SynonymsPTP-1B, PTP1B
MMRRC Submission 044280-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.935) question?
Stock #R6133 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location167932057-167979385 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 167967796 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 108 (V108A)
Ref Sequence ENSEMBL: ENSMUSP00000029053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029053]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029053
AA Change: V108A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000029053
Gene: ENSMUSG00000027540
AA Change: V108A

DomainStartEndE-ValueType
PTPc 15 279 1.35e-123 SMART
low complexity region 301 320 N/A INTRINSIC
low complexity region 354 364 N/A INTRINSIC
low complexity region 387 397 N/A INTRINSIC
transmembrane domain 409 431 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126839
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144249
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147210
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151705
Meta Mutation Damage Score 0.7584 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the founding member of the protein tyrosine phosphatase (PTP) family, which was isolated and identified based on its enzymatic activity and amino acid sequence. PTPs catalyze the hydrolysis of the phosphate monoesters specifically on tyrosine residues. Members of the PTP family share a highly conserved catalytic motif, which is essential for the catalytic activity. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP has been shown to act as a negative regulator of insulin signaling by dephosphorylating the phosphotryosine residues of insulin receptor kinase. This PTP was also reported to dephosphorylate epidermal growth factor receptor kinase, as well as JAK2 and TYK2 kinases, which implicated the role of this PTP in cell growth control, and cell response to interferon stimulation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit greatly reduced adiposity due to reduced fat cell mass, increased basal metabolic rate, mild hypoglycemia and hypoinsulinemia, increased insulin sensitivity, and enhanced sensitivity to leptin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 A G 8: 88,325,439 T912A possibly damaging Het
Akap12 G T 10: 4,355,178 G663C probably benign Het
Akap2 C T 4: 57,855,516 Q525* probably null Het
Ankhd1 T C 18: 36,625,126 S958P possibly damaging Het
Cmtm2a T C 8: 104,292,730 I76V probably benign Het
Cpxm2 G A 7: 132,128,453 P146S probably damaging Het
Cubn A G 2: 13,308,618 V3047A probably benign Het
Dgkd T A 1: 87,938,240 V198E possibly damaging Het
Dnah3 A T 7: 120,086,246 M181K probably benign Het
Dnah7a T C 1: 53,419,655 T3775A probably benign Het
Dsg2 A G 18: 20,590,089 I391V probably benign Het
Ebi3 T A 17: 55,954,311 V69E probably benign Het
Fn1 T C 1: 71,597,727 T1998A probably damaging Het
Frmpd1 T A 4: 45,284,915 H1245Q probably benign Het
Gm7145 T A 1: 117,985,888 C167S probably damaging Het
Hydin C T 8: 110,601,276 T4805I probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnma1 C T 14: 24,003,868 M21I probably damaging Het
Lrfn5 A G 12: 61,843,788 D621G probably benign Het
Lrrc15 C T 16: 30,274,236 G95D probably benign Het
Mex3d A G 10: 80,386,786 L212P probably damaging Het
Mmel1 C T 4: 154,895,018 H728Y probably damaging Het
Naip1 A G 13: 100,444,643 V32A probably benign Het
Nsl1 T C 1: 191,071,206 L158P probably damaging Het
Olfr638 A T 7: 104,003,325 T17S possibly damaging Het
Olfr771 G A 10: 129,160,883 L34F possibly damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Pcdh15 A T 10: 74,645,973 probably null Het
Pramef20 T C 4: 144,377,777 R53G possibly damaging Het
Rad9b T C 5: 122,339,768 N182D possibly damaging Het
Rp1l1 C T 14: 64,030,096 P1044S probably damaging Het
Scn2a G A 2: 65,743,104 V1433I probably benign Het
Ssrp1 T G 2: 85,045,339 probably benign Het
Suco T A 1: 161,835,183 K560* probably null Het
Tbx3 T C 5: 119,680,953 V531A probably benign Het
Tmem30c T C 16: 57,277,737 Y107C probably damaging Het
Topbp1 T A 9: 103,311,764 probably null Het
Trpm5 A T 7: 143,088,951 D86E probably damaging Het
Urb2 C T 8: 124,028,561 Q336* probably null Het
Vmn2r43 A G 7: 8,244,971 F731S probably damaging Het
Xkr9 A G 1: 13,684,135 T118A probably benign Het
Zcchc2 A C 1: 106,019,879 K117N probably damaging Het
Zfp52 T C 17: 21,560,471 Y194H probably damaging Het
Zfp763 C T 17: 33,018,701 C490Y possibly damaging Het
Zmynd19 G T 2: 24,958,119 R148L possibly damaging Het
Other mutations in Ptpn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01482:Ptpn1 APN 2 167967792 missense probably damaging 1.00
IGL02976:Ptpn1 APN 2 167971784 missense probably benign 0.01
R0106:Ptpn1 UTSW 2 167976418 unclassified probably benign
R0106:Ptpn1 UTSW 2 167976418 unclassified probably benign
R1438:Ptpn1 UTSW 2 167976609 missense probably damaging 0.99
R3010:Ptpn1 UTSW 2 167974822 missense probably damaging 1.00
R3607:Ptpn1 UTSW 2 167975507 missense probably benign
R3755:Ptpn1 UTSW 2 167974223 missense probably damaging 1.00
R4075:Ptpn1 UTSW 2 167976513 unclassified probably null
R4160:Ptpn1 UTSW 2 167967811 missense probably benign 0.04
R4627:Ptpn1 UTSW 2 167967781 missense probably benign 0.00
R4754:Ptpn1 UTSW 2 167974160 missense probably damaging 1.00
R5596:Ptpn1 UTSW 2 167974763 missense probably damaging 1.00
R5920:Ptpn1 UTSW 2 167971748 missense probably benign 0.02
R7296:Ptpn1 UTSW 2 167974772 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CACATGATGGGATGTGGGAC -3'
(R):5'- CTCCCTAGTGTGGTCTGTAATAAAAG -3'

Sequencing Primer
(F):5'- GGACTGGGTGACTGACGG -3'
(R):5'- GGGGAGCTTTAAGAACTG -3'
Posted On2017-10-10