Mutagenetix > Incidental Mutations

Incidental Mutation 'R6133:Trpm5'

487236

Institutional Source

Beutler Lab

Gene Symbol

Trpm5

Ensembl Gene

ENSMUSG00000009246

Gene Name

transient receptor potential cation channel, subfamily M, member 5

Synonyms

9430099A16Rik, Mtr1, Ltrpc5

MMRRC Submission

044280-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.095) question?

Stock #

R6133 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

143069153-143094642 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 143088951 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 86 (D86E)

Ref Sequence

ENSEMBL: ENSMUSP00000114302 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000009390] [ENSMUST00000150867]

Predicted Effect

probably damaging
Transcript: ENSMUST00000009390
AA Change: D86E

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000009390
Gene: ENSMUSG00000009246
AA Change: D86E

Domain	Start	End	E-Value	Type
Blast:ANK	382	411	2e-6	BLAST
transmembrane domain	644	666	N/A	INTRINSIC
Pfam:Ion_trans	736	989	1.2e-11	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146075

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150589

Predicted Effect

probably damaging
Transcript: ENSMUST00000150867
AA Change: D86E

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000114302
Gene: ENSMUSG00000009246
AA Change: D86E

Domain	Start	End	E-Value	Type
Blast:ANK	382	411	2e-6	BLAST
transmembrane domain	644	666	N/A	INTRINSIC
transmembrane domain	731	753	N/A	INTRINSIC
transmembrane domain	811	833	N/A	INTRINSIC
transmembrane domain	872	894	N/A	INTRINSIC
transmembrane domain	952	974	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.2%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential (TRP) protein family, which is a diverse group of proteins with structural features typical of ion channels. This protein plays an important role in taste transduction, and has characteristics of a calcium-activated, non-selective cation channel that carries Na+, K+, and Cs+ ions equally well, but not Ca(2+) ions. It is activated by lower concentrations of intracellular Ca(2+), and inhibited by higher concentrations. It is also a highly temperature-sensitive, heat activated channel showing a steep increase of inward currents at temperatures between 15 and 35 degrees Celsius. This gene is located within the Beckwith-Wiedemann syndrome critical region-1 on chromosome 11p15.5, and has been shown to be imprinted, with exclusive expression from the paternal allele. [provided by RefSeq, Oct 2010]
PHENOTYPE: Homozygous mutant mice demonstrate abnormal taste perception, responding to sour and salty stimuli but not to sweet, or bitter stimuli. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy7	A	G	8: 88,325,439	T912A	possibly damaging	Het
Akap12	G	T	10: 4,355,178	G663C	probably benign	Het
Akap2	C	T	4: 57,855,516	Q525*	probably null	Het
Ankhd1	T	C	18: 36,625,126	S958P	possibly damaging	Het
Cmtm2a	T	C	8: 104,292,730	I76V	probably benign	Het
Cpxm2	G	A	7: 132,128,453	P146S	probably damaging	Het
Cubn	A	G	2: 13,308,618	V3047A	probably benign	Het
Dgkd	T	A	1: 87,938,240	V198E	possibly damaging	Het
Dnah3	A	T	7: 120,086,246	M181K	probably benign	Het
Dnah7a	T	C	1: 53,419,655	T3775A	probably benign	Het
Dsg2	A	G	18: 20,590,089	I391V	probably benign	Het
Ebi3	T	A	17: 55,954,311	V69E	probably benign	Het
Fn1	T	C	1: 71,597,727	T1998A	probably damaging	Het
Frmpd1	T	A	4: 45,284,915	H1245Q	probably benign	Het
Gm7145	T	A	1: 117,985,888	C167S	probably damaging	Het
Hydin	C	T	8: 110,601,276	T4805I	probably benign	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Kcnma1	C	T	14: 24,003,868	M21I	probably damaging	Het
Lrfn5	A	G	12: 61,843,788	D621G	probably benign	Het
Lrrc15	C	T	16: 30,274,236	G95D	probably benign	Het
Mex3d	A	G	10: 80,386,786	L212P	probably damaging	Het
Mmel1	C	T	4: 154,895,018	H728Y	probably damaging	Het
Naip1	A	G	13: 100,444,643	V32A	probably benign	Het
Nsl1	T	C	1: 191,071,206	L158P	probably damaging	Het
Olfr638	A	T	7: 104,003,325	T17S	possibly damaging	Het
Olfr771	G	A	10: 129,160,883	L34F	possibly damaging	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
Pcdh15	A	T	10: 74,645,973		probably null	Het
Pramef20	T	C	4: 144,377,777	R53G	possibly damaging	Het
Ptpn1	T	C	2: 167,967,796	V108A	possibly damaging	Het
Rad9b	T	C	5: 122,339,768	N182D	possibly damaging	Het
Rp1l1	C	T	14: 64,030,096	P1044S	probably damaging	Het
Scn2a	G	A	2: 65,743,104	V1433I	probably benign	Het
Ssrp1	T	G	2: 85,045,339		probably benign	Het
Suco	T	A	1: 161,835,183	K560*	probably null	Het
Tbx3	T	C	5: 119,680,953	V531A	probably benign	Het
Tmem30c	T	C	16: 57,277,737	Y107C	probably damaging	Het
Topbp1	T	A	9: 103,311,764		probably null	Het
Urb2	C	T	8: 124,028,561	Q336*	probably null	Het
Vmn2r43	A	G	7: 8,244,971	F731S	probably damaging	Het
Xkr9	A	G	1: 13,684,135	T118A	probably benign	Het
Zcchc2	A	C	1: 106,019,879	K117N	probably damaging	Het
Zfp52	T	C	17: 21,560,471	Y194H	probably damaging	Het
Zfp763	C	T	17: 33,018,701	C490Y	possibly damaging	Het
Zmynd19	G	T	2: 24,958,119	R148L	possibly damaging	Het

Other mutations in Trpm5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00309:Trpm5	APN	7	143082991	missense	probably benign	0.03
IGL00717:Trpm5	APN	7	143073990	missense	probably damaging	1.00
IGL01138:Trpm5	APN	7	143074569	missense	probably benign
IGL01590:Trpm5	APN	7	143082734	missense	probably damaging	0.99
IGL01603:Trpm5	APN	7	143075601	missense	probably benign	0.04
IGL01685:Trpm5	APN	7	143082354	missense	probably benign	0.05
IGL01878:Trpm5	APN	7	143074497	missense	probably damaging	1.00
IGL02533:Trpm5	APN	7	143089545	missense	probably benign	0.01
IGL02572:Trpm5	APN	7	143087876	splice site	probably benign
IGL02750:Trpm5	APN	7	143074484	missense	possibly damaging	0.89
IGL02862:Trpm5	APN	7	143082525	missense	probably damaging	1.00
R0032:Trpm5	UTSW	7	143085241	missense	probably damaging	1.00
R0238:Trpm5	UTSW	7	143082958	missense	probably damaging	1.00
R0238:Trpm5	UTSW	7	143082958	missense	probably damaging	1.00
R0239:Trpm5	UTSW	7	143082958	missense	probably damaging	1.00
R0239:Trpm5	UTSW	7	143082958	missense	probably damaging	1.00
R0334:Trpm5	UTSW	7	143086876	missense	probably benign	0.06
R0799:Trpm5	UTSW	7	143078351	missense	probably damaging	0.99
R1187:Trpm5	UTSW	7	143074469	missense	probably damaging	0.96
R1373:Trpm5	UTSW	7	143086842	splice site	probably benign
R1521:Trpm5	UTSW	7	143082889	missense	probably benign	0.00
R1603:Trpm5	UTSW	7	143085209	missense	probably benign	0.00
R1606:Trpm5	UTSW	7	143085171	nonsense	probably null
R2009:Trpm5	UTSW	7	143087738	missense	possibly damaging	0.58
R2437:Trpm5	UTSW	7	143082561	missense	probably benign	0.03
R2508:Trpm5	UTSW	7	143088919	missense	possibly damaging	0.80
R2516:Trpm5	UTSW	7	143074517	missense	probably damaging	1.00
R2985:Trpm5	UTSW	7	143082938	missense	probably damaging	0.99
R3036:Trpm5	UTSW	7	143085463	missense	probably benign	0.00
R3037:Trpm5	UTSW	7	143085463	missense	probably benign	0.00
R3688:Trpm5	UTSW	7	143078456	missense	probably damaging	0.98
R4156:Trpm5	UTSW	7	143089055	missense	probably benign	0.04
R4734:Trpm5	UTSW	7	143082785	missense	probably benign	0.04
R4811:Trpm5	UTSW	7	143080219	missense	probably damaging	1.00
R4814:Trpm5	UTSW	7	143082636	missense	possibly damaging	0.50
R4847:Trpm5	UTSW	7	143087763	missense	possibly damaging	0.89
R5055:Trpm5	UTSW	7	143072784	missense	probably benign	0.00
R5256:Trpm5	UTSW	7	143082303	missense	probably damaging	1.00
R5413:Trpm5	UTSW	7	143080968	missense	probably damaging	1.00
R5668:Trpm5	UTSW	7	143073229	missense	probably benign	0.39
R6242:Trpm5	UTSW	7	143073182	missense	probably benign
R6564:Trpm5	UTSW	7	143072770	missense	probably damaging	1.00
R6702:Trpm5	UTSW	7	143069318	unclassified	probably benign
R6703:Trpm5	UTSW	7	143069318	unclassified	probably benign
R6829:Trpm5	UTSW	7	143069429	unclassified	probably benign
R6940:Trpm5	UTSW	7	143084810	nonsense	probably null
R7337:Trpm5	UTSW	7	143089019	missense	probably benign	0.01
R7513:Trpm5	UTSW	7	143081835	missense	possibly damaging	0.84
R7560:Trpm5	UTSW	7	143080986	missense	probably damaging	1.00
R7801:Trpm5	UTSW	7	143085241	missense	probably damaging	1.00
R7961:Trpm5	UTSW	7	143080369	missense	probably benign	0.00
R8009:Trpm5	UTSW	7	143080369	missense	probably benign	0.00
R8189:Trpm5	UTSW	7	143081838	missense	probably benign	0.32
R8441:Trpm5	UTSW	7	143072434	missense	possibly damaging	0.75
R8507:Trpm5	UTSW	7	143078313	missense	probably damaging	1.00
X0022:Trpm5	UTSW	7	143083042	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- AACCACTTCTGCAATGAGAGA -3'
(R):5'- TGTCTACCACCTGGAACCCA -3'

Sequencing Primer
(F):5'- GGAGTTACAAGCAGCTTCCAGC -3'
(R):5'- ACCAGCCCCTTACCCTG -3'

Posted On

2017-10-10