Incidental Mutation 'R6133:Trpm5'
ID487236
Institutional Source Beutler Lab
Gene Symbol Trpm5
Ensembl Gene ENSMUSG00000009246
Gene Nametransient receptor potential cation channel, subfamily M, member 5
Synonyms9430099A16Rik, Mtr1, Ltrpc5
MMRRC Submission 044280-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R6133 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location143069153-143094642 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 143088951 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 86 (D86E)
Ref Sequence ENSEMBL: ENSMUSP00000114302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009390] [ENSMUST00000150867]
Predicted Effect probably damaging
Transcript: ENSMUST00000009390
AA Change: D86E

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000009390
Gene: ENSMUSG00000009246
AA Change: D86E

DomainStartEndE-ValueType
Blast:ANK 382 411 2e-6 BLAST
transmembrane domain 644 666 N/A INTRINSIC
Pfam:Ion_trans 736 989 1.2e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146075
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150589
Predicted Effect probably damaging
Transcript: ENSMUST00000150867
AA Change: D86E

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114302
Gene: ENSMUSG00000009246
AA Change: D86E

DomainStartEndE-ValueType
Blast:ANK 382 411 2e-6 BLAST
transmembrane domain 644 666 N/A INTRINSIC
transmembrane domain 731 753 N/A INTRINSIC
transmembrane domain 811 833 N/A INTRINSIC
transmembrane domain 872 894 N/A INTRINSIC
transmembrane domain 952 974 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential (TRP) protein family, which is a diverse group of proteins with structural features typical of ion channels. This protein plays an important role in taste transduction, and has characteristics of a calcium-activated, non-selective cation channel that carries Na+, K+, and Cs+ ions equally well, but not Ca(2+) ions. It is activated by lower concentrations of intracellular Ca(2+), and inhibited by higher concentrations. It is also a highly temperature-sensitive, heat activated channel showing a steep increase of inward currents at temperatures between 15 and 35 degrees Celsius. This gene is located within the Beckwith-Wiedemann syndrome critical region-1 on chromosome 11p15.5, and has been shown to be imprinted, with exclusive expression from the paternal allele. [provided by RefSeq, Oct 2010]
PHENOTYPE: Homozygous mutant mice demonstrate abnormal taste perception, responding to sour and salty stimuli but not to sweet, or bitter stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 A G 8: 88,325,439 T912A possibly damaging Het
Akap12 G T 10: 4,355,178 G663C probably benign Het
Akap2 C T 4: 57,855,516 Q525* probably null Het
Ankhd1 T C 18: 36,625,126 S958P possibly damaging Het
Cmtm2a T C 8: 104,292,730 I76V probably benign Het
Cpxm2 G A 7: 132,128,453 P146S probably damaging Het
Cubn A G 2: 13,308,618 V3047A probably benign Het
Dgkd T A 1: 87,938,240 V198E possibly damaging Het
Dnah3 A T 7: 120,086,246 M181K probably benign Het
Dnah7a T C 1: 53,419,655 T3775A probably benign Het
Dsg2 A G 18: 20,590,089 I391V probably benign Het
Ebi3 T A 17: 55,954,311 V69E probably benign Het
Fn1 T C 1: 71,597,727 T1998A probably damaging Het
Frmpd1 T A 4: 45,284,915 H1245Q probably benign Het
Gm7145 T A 1: 117,985,888 C167S probably damaging Het
Hydin C T 8: 110,601,276 T4805I probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnma1 C T 14: 24,003,868 M21I probably damaging Het
Lrfn5 A G 12: 61,843,788 D621G probably benign Het
Lrrc15 C T 16: 30,274,236 G95D probably benign Het
Mex3d A G 10: 80,386,786 L212P probably damaging Het
Mmel1 C T 4: 154,895,018 H728Y probably damaging Het
Naip1 A G 13: 100,444,643 V32A probably benign Het
Nsl1 T C 1: 191,071,206 L158P probably damaging Het
Olfr638 A T 7: 104,003,325 T17S possibly damaging Het
Olfr771 G A 10: 129,160,883 L34F possibly damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Pcdh15 A T 10: 74,645,973 probably null Het
Pramef20 T C 4: 144,377,777 R53G possibly damaging Het
Ptpn1 T C 2: 167,967,796 V108A possibly damaging Het
Rad9b T C 5: 122,339,768 N182D possibly damaging Het
Rp1l1 C T 14: 64,030,096 P1044S probably damaging Het
Scn2a G A 2: 65,743,104 V1433I probably benign Het
Ssrp1 T G 2: 85,045,339 probably benign Het
Suco T A 1: 161,835,183 K560* probably null Het
Tbx3 T C 5: 119,680,953 V531A probably benign Het
Tmem30c T C 16: 57,277,737 Y107C probably damaging Het
Topbp1 T A 9: 103,311,764 probably null Het
Urb2 C T 8: 124,028,561 Q336* probably null Het
Vmn2r43 A G 7: 8,244,971 F731S probably damaging Het
Xkr9 A G 1: 13,684,135 T118A probably benign Het
Zcchc2 A C 1: 106,019,879 K117N probably damaging Het
Zfp52 T C 17: 21,560,471 Y194H probably damaging Het
Zfp763 C T 17: 33,018,701 C490Y possibly damaging Het
Zmynd19 G T 2: 24,958,119 R148L possibly damaging Het
Other mutations in Trpm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Trpm5 APN 7 143082991 missense probably benign 0.03
IGL00717:Trpm5 APN 7 143073990 missense probably damaging 1.00
IGL01138:Trpm5 APN 7 143074569 missense probably benign
IGL01590:Trpm5 APN 7 143082734 missense probably damaging 0.99
IGL01603:Trpm5 APN 7 143075601 missense probably benign 0.04
IGL01685:Trpm5 APN 7 143082354 missense probably benign 0.05
IGL01878:Trpm5 APN 7 143074497 missense probably damaging 1.00
IGL02533:Trpm5 APN 7 143089545 missense probably benign 0.01
IGL02572:Trpm5 APN 7 143087876 splice site probably benign
IGL02750:Trpm5 APN 7 143074484 missense possibly damaging 0.89
IGL02862:Trpm5 APN 7 143082525 missense probably damaging 1.00
R0032:Trpm5 UTSW 7 143085241 missense probably damaging 1.00
R0238:Trpm5 UTSW 7 143082958 missense probably damaging 1.00
R0238:Trpm5 UTSW 7 143082958 missense probably damaging 1.00
R0239:Trpm5 UTSW 7 143082958 missense probably damaging 1.00
R0239:Trpm5 UTSW 7 143082958 missense probably damaging 1.00
R0334:Trpm5 UTSW 7 143086876 missense probably benign 0.06
R0799:Trpm5 UTSW 7 143078351 missense probably damaging 0.99
R1187:Trpm5 UTSW 7 143074469 missense probably damaging 0.96
R1373:Trpm5 UTSW 7 143086842 splice site probably benign
R1521:Trpm5 UTSW 7 143082889 missense probably benign 0.00
R1603:Trpm5 UTSW 7 143085209 missense probably benign 0.00
R1606:Trpm5 UTSW 7 143085171 nonsense probably null
R2009:Trpm5 UTSW 7 143087738 missense possibly damaging 0.58
R2437:Trpm5 UTSW 7 143082561 missense probably benign 0.03
R2508:Trpm5 UTSW 7 143088919 missense possibly damaging 0.80
R2516:Trpm5 UTSW 7 143074517 missense probably damaging 1.00
R2985:Trpm5 UTSW 7 143082938 missense probably damaging 0.99
R3036:Trpm5 UTSW 7 143085463 missense probably benign 0.00
R3037:Trpm5 UTSW 7 143085463 missense probably benign 0.00
R3688:Trpm5 UTSW 7 143078456 missense probably damaging 0.98
R4156:Trpm5 UTSW 7 143089055 missense probably benign 0.04
R4734:Trpm5 UTSW 7 143082785 missense probably benign 0.04
R4811:Trpm5 UTSW 7 143080219 missense probably damaging 1.00
R4814:Trpm5 UTSW 7 143082636 missense possibly damaging 0.50
R4847:Trpm5 UTSW 7 143087763 missense possibly damaging 0.89
R5055:Trpm5 UTSW 7 143072784 missense probably benign 0.00
R5256:Trpm5 UTSW 7 143082303 missense probably damaging 1.00
R5413:Trpm5 UTSW 7 143080968 missense probably damaging 1.00
R5668:Trpm5 UTSW 7 143073229 missense probably benign 0.39
R6242:Trpm5 UTSW 7 143073182 missense probably benign
R6564:Trpm5 UTSW 7 143072770 missense probably damaging 1.00
R6702:Trpm5 UTSW 7 143069318 unclassified probably benign
R6703:Trpm5 UTSW 7 143069318 unclassified probably benign
R6829:Trpm5 UTSW 7 143069429 unclassified probably benign
R6940:Trpm5 UTSW 7 143084810 nonsense probably null
R7337:Trpm5 UTSW 7 143089019 missense probably benign 0.01
R7513:Trpm5 UTSW 7 143081835 missense possibly damaging 0.84
R7560:Trpm5 UTSW 7 143080986 missense probably damaging 1.00
R7801:Trpm5 UTSW 7 143085241 missense probably damaging 1.00
X0022:Trpm5 UTSW 7 143083042 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AACCACTTCTGCAATGAGAGA -3'
(R):5'- TGTCTACCACCTGGAACCCA -3'

Sequencing Primer
(F):5'- GGAGTTACAAGCAGCTTCCAGC -3'
(R):5'- ACCAGCCCCTTACCCTG -3'
Posted On2017-10-10