Mutagenetix > Incidental Mutations

Incidental Mutation 'R6133:Akap12'

487242

Institutional Source

Beutler Lab

Gene Symbol

Akap12

Ensembl Gene

ENSMUSG00000038587

Gene Name

A kinase (PRKA) anchor protein (gravin) 12

Synonyms

SSeCKS, Tsga12, Srcs5

MMRRC Submission

044280-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.098) question?

Stock #

R6133 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

4266380-4359470 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 4355178 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Cysteine at position 663 (G663C)

Ref Sequence

ENSEMBL: ENSMUSP00000150261 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045730] [ENSMUST00000215696]

Predicted Effect

probably benign
Transcript: ENSMUST00000045730
AA Change: G768C

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000035829
Gene: ENSMUSG00000038587
AA Change: G768C

Domain	Start	End	E-Value	Type
low complexity region	30	48	N/A	INTRINSIC
low complexity region	120	132	N/A	INTRINSIC
low complexity region	151	171	N/A	INTRINSIC
low complexity region	187	198	N/A	INTRINSIC
internal_repeat_1	212	279	3.2e-5	PROSPERO
coiled coil region	304	331	N/A	INTRINSIC
low complexity region	387	398	N/A	INTRINSIC
low complexity region	407	424	N/A	INTRINSIC
low complexity region	432	446	N/A	INTRINSIC
low complexity region	497	526	N/A	INTRINSIC
low complexity region	550	561	N/A	INTRINSIC
low complexity region	571	582	N/A	INTRINSIC
Pfam:WSK	591	619	2e-15	PFAM
low complexity region	626	637	N/A	INTRINSIC
low complexity region	673	684	N/A	INTRINSIC
low complexity region	700	711	N/A	INTRINSIC
Pfam:WSK	738	766	2.3e-15	PFAM
Pfam:WSK	779	807	6.2e-11	PFAM
low complexity region	951	973	N/A	INTRINSIC
low complexity region	1050	1065	N/A	INTRINSIC
low complexity region	1177	1187	N/A	INTRINSIC
internal_repeat_1	1197	1265	3.2e-5	PROSPERO
low complexity region	1303	1312	N/A	INTRINSIC
Pfam:RII_binding_1	1501	1518	4.2e-7	PFAM
coiled coil region	1651	1676	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000215696
AA Change: G663C

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216139

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.2%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is expressed in endothelial cells, cultured fibroblasts, and osteosarcoma cells. It associates with protein kinases A and C and phosphatase, and serves as a scaffold protein in signal transduction. This protein and RII PKA colocalize at the cell periphery. This protein is a cell growth-related protein. Antibodies to this protein can be produced by patients with myasthenia gravis. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knockout allele disrupting all three common isoforms suffer from prostatic hyperplasia and focal dysplasia, and from delayed fertility. Mice homozygous for a gene trap allele exhibit enhanced cardiac function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy7	A	G	8: 88,325,439	T912A	possibly damaging	Het
Akap2	C	T	4: 57,855,516	Q525*	probably null	Het
Ankhd1	T	C	18: 36,625,126	S958P	possibly damaging	Het
Cmtm2a	T	C	8: 104,292,730	I76V	probably benign	Het
Cpxm2	G	A	7: 132,128,453	P146S	probably damaging	Het
Cubn	A	G	2: 13,308,618	V3047A	probably benign	Het
Dgkd	T	A	1: 87,938,240	V198E	possibly damaging	Het
Dnah3	A	T	7: 120,086,246	M181K	probably benign	Het
Dnah7a	T	C	1: 53,419,655	T3775A	probably benign	Het
Dsg2	A	G	18: 20,590,089	I391V	probably benign	Het
Ebi3	T	A	17: 55,954,311	V69E	probably benign	Het
Fn1	T	C	1: 71,597,727	T1998A	probably damaging	Het
Frmpd1	T	A	4: 45,284,915	H1245Q	probably benign	Het
Gm7145	T	A	1: 117,985,888	C167S	probably damaging	Het
Hydin	C	T	8: 110,601,276	T4805I	probably benign	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Kcnma1	C	T	14: 24,003,868	M21I	probably damaging	Het
Lrfn5	A	G	12: 61,843,788	D621G	probably benign	Het
Lrrc15	C	T	16: 30,274,236	G95D	probably benign	Het
Mex3d	A	G	10: 80,386,786	L212P	probably damaging	Het
Mmel1	C	T	4: 154,895,018	H728Y	probably damaging	Het
Naip1	A	G	13: 100,444,643	V32A	probably benign	Het
Nsl1	T	C	1: 191,071,206	L158P	probably damaging	Het
Olfr638	A	T	7: 104,003,325	T17S	possibly damaging	Het
Olfr771	G	A	10: 129,160,883	L34F	possibly damaging	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
Pcdh15	A	T	10: 74,645,973		probably null	Het
Pramef20	T	C	4: 144,377,777	R53G	possibly damaging	Het
Ptpn1	T	C	2: 167,967,796	V108A	possibly damaging	Het
Rad9b	T	C	5: 122,339,768	N182D	possibly damaging	Het
Rp1l1	C	T	14: 64,030,096	P1044S	probably damaging	Het
Scn2a	G	A	2: 65,743,104	V1433I	probably benign	Het
Ssrp1	T	G	2: 85,045,339		probably benign	Het
Suco	T	A	1: 161,835,183	K560*	probably null	Het
Tbx3	T	C	5: 119,680,953	V531A	probably benign	Het
Tmem30c	T	C	16: 57,277,737	Y107C	probably damaging	Het
Topbp1	T	A	9: 103,311,764		probably null	Het
Trpm5	A	T	7: 143,088,951	D86E	probably damaging	Het
Urb2	C	T	8: 124,028,561	Q336*	probably null	Het
Vmn2r43	A	G	7: 8,244,971	F731S	probably damaging	Het
Xkr9	A	G	1: 13,684,135	T118A	probably benign	Het
Zcchc2	A	C	1: 106,019,879	K117N	probably damaging	Het
Zfp52	T	C	17: 21,560,471	Y194H	probably damaging	Het
Zfp763	C	T	17: 33,018,701	C490Y	possibly damaging	Het
Zmynd19	G	T	2: 24,958,119	R148L	possibly damaging	Het

Other mutations in Akap12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00712:Akap12	APN	10	4357164	missense	probably benign	0.09
IGL01306:Akap12	APN	10	4353273	missense	probably benign	0.04
IGL01360:Akap12	APN	10	4357537	missense	probably benign	0.02
IGL01455:Akap12	APN	10	4356886	missense	probably damaging	0.99
IGL01458:Akap12	APN	10	4354060	missense	probably damaging	1.00
IGL01465:Akap12	APN	10	4356886	missense	probably damaging	0.99
IGL02348:Akap12	APN	10	4354722	missense	probably damaging	1.00
IGL02425:Akap12	APN	10	4356034	missense	possibly damaging	0.67
IGL02502:Akap12	APN	10	4353163	missense	probably damaging	1.00
IGL02736:Akap12	APN	10	4355637	missense	probably benign
IGL02969:Akap12	APN	10	4354864	missense	probably damaging	1.00
IGL03345:Akap12	APN	10	4356697	missense	probably benign	0.42
ANU23:Akap12	UTSW	10	4353273	missense	probably benign	0.04
FR4976:Akap12	UTSW	10	4353837	small insertion	probably benign
R0004:Akap12	UTSW	10	4353220	missense	probably damaging	1.00
R0004:Akap12	UTSW	10	4353218	missense	possibly damaging	0.56
R0207:Akap12	UTSW	10	4353333	missense	probably damaging	1.00
R0580:Akap12	UTSW	10	4354741	missense	possibly damaging	0.91
R0675:Akap12	UTSW	10	4353315	missense	probably benign	0.06
R1248:Akap12	UTSW	10	4353847	missense	probably benign	0.11
R1338:Akap12	UTSW	10	4313773	missense	possibly damaging	0.95
R1448:Akap12	UTSW	10	4355475	missense	probably benign	0.22
R1458:Akap12	UTSW	10	4353693	missense	probably damaging	1.00
R1521:Akap12	UTSW	10	4354804	missense	probably benign	0.02
R1585:Akap12	UTSW	10	4353640	missense	probably benign	0.11
R1725:Akap12	UTSW	10	4353942	missense	probably damaging	1.00
R1756:Akap12	UTSW	10	4357574	missense	probably benign	0.04
R1914:Akap12	UTSW	10	4356685	missense	probably benign	0.01
R1978:Akap12	UTSW	10	4313855	missense	probably benign	0.06
R2032:Akap12	UTSW	10	4356673	missense	possibly damaging	0.50
R2041:Akap12	UTSW	10	4356489	missense	probably benign	0.01
R3009:Akap12	UTSW	10	4357891	missense	probably benign	0.06
R3872:Akap12	UTSW	10	4357590	missense	probably benign	0.00
R3874:Akap12	UTSW	10	4357590	missense	probably benign	0.00
R3875:Akap12	UTSW	10	4357590	missense	probably benign	0.00
R3944:Akap12	UTSW	10	4357347	missense	probably benign	0.00
R4612:Akap12	UTSW	10	4354456	missense	probably damaging	1.00
R4889:Akap12	UTSW	10	4356535	missense	probably damaging	0.97
R5043:Akap12	UTSW	10	4355047	missense	probably damaging	1.00
R5176:Akap12	UTSW	10	4353947	missense	probably benign	0.19
R5278:Akap12	UTSW	10	4354792	missense	probably benign	0.02
R5320:Akap12	UTSW	10	4357291	missense	probably benign	0.00
R5443:Akap12	UTSW	10	4355576	missense	probably damaging	1.00
R5533:Akap12	UTSW	10	4357405	missense	probably damaging	1.00
R6142:Akap12	UTSW	10	4313740	splice site	probably null
R6190:Akap12	UTSW	10	4356268	missense	possibly damaging	0.92
R6458:Akap12	UTSW	10	4355148	missense	probably damaging	1.00
R6562:Akap12	UTSW	10	4356141	nonsense	probably null
R6701:Akap12	UTSW	10	4355243	missense	probably damaging	1.00
R6828:Akap12	UTSW	10	4354606	missense	probably damaging	0.96
R6991:Akap12	UTSW	10	4357122	nonsense	probably null
R7023:Akap12	UTSW	10	4356895	missense	probably benign	0.05
R7102:Akap12	UTSW	10	4353226	missense	probably damaging	1.00
R7483:Akap12	UTSW	10	4353967	missense	probably benign	0.00
R7538:Akap12	UTSW	10	4353213	missense	probably damaging	1.00
R7664:Akap12	UTSW	10	4353748	missense	probably damaging	1.00
R7704:Akap12	UTSW	10	4356082	missense	probably damaging	1.00
R8447:Akap12	UTSW	10	4356289	missense	probably benign	0.32
R8502:Akap12	UTSW	10	4313856	missense	probably benign	0.22

Predicted Primers

PCR Primer
(F):5'- GGAAGGCATCCTCTTCAGATG -3'
(R):5'- ACCGCATCGTACTCAGACAG -3'

Sequencing Primer
(F):5'- TTCAGATGATGAAGGAGGGCC -3'
(R):5'- TCAGACAGAGGCACAACAGCTG -3'

Posted On

2017-10-10