Incidental Mutation 'R6133:Olfr771'
ID487245
Institutional Source Beutler Lab
Gene Symbol Olfr771
Ensembl Gene ENSMUSG00000061367
Gene Nameolfactory receptor 771
SynonymsMOR114-8, GA_x6K02T2PULF-10846420-10845467
MMRRC Submission 044280-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R6133 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location129160003-129164751 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 129160883 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 34 (L34F)
Ref Sequence ENSEMBL: ENSMUSP00000151108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078914] [ENSMUST00000214271]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078914
AA Change: L34F

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000077948
Gene: ENSMUSG00000061367
AA Change: L34F

DomainStartEndE-ValueType
Pfam:7tm_4 28 304 8.9e-48 PFAM
Pfam:7tm_1 38 287 3e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214271
AA Change: L34F

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 A G 8: 88,325,439 T912A possibly damaging Het
Akap12 G T 10: 4,355,178 G663C probably benign Het
Akap2 C T 4: 57,855,516 Q525* probably null Het
Ankhd1 T C 18: 36,625,126 S958P possibly damaging Het
Cmtm2a T C 8: 104,292,730 I76V probably benign Het
Cpxm2 G A 7: 132,128,453 P146S probably damaging Het
Cubn A G 2: 13,308,618 V3047A probably benign Het
Dgkd T A 1: 87,938,240 V198E possibly damaging Het
Dnah3 A T 7: 120,086,246 M181K probably benign Het
Dnah7a T C 1: 53,419,655 T3775A probably benign Het
Dsg2 A G 18: 20,590,089 I391V probably benign Het
Ebi3 T A 17: 55,954,311 V69E probably benign Het
Fn1 T C 1: 71,597,727 T1998A probably damaging Het
Frmpd1 T A 4: 45,284,915 H1245Q probably benign Het
Gm7145 T A 1: 117,985,888 C167S probably damaging Het
Hydin C T 8: 110,601,276 T4805I probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnma1 C T 14: 24,003,868 M21I probably damaging Het
Lrfn5 A G 12: 61,843,788 D621G probably benign Het
Lrrc15 C T 16: 30,274,236 G95D probably benign Het
Mex3d A G 10: 80,386,786 L212P probably damaging Het
Mmel1 C T 4: 154,895,018 H728Y probably damaging Het
Naip1 A G 13: 100,444,643 V32A probably benign Het
Nsl1 T C 1: 191,071,206 L158P probably damaging Het
Olfr638 A T 7: 104,003,325 T17S possibly damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Pcdh15 A T 10: 74,645,973 probably null Het
Pramef20 T C 4: 144,377,777 R53G possibly damaging Het
Ptpn1 T C 2: 167,967,796 V108A possibly damaging Het
Rad9b T C 5: 122,339,768 N182D possibly damaging Het
Rp1l1 C T 14: 64,030,096 P1044S probably damaging Het
Scn2a G A 2: 65,743,104 V1433I probably benign Het
Ssrp1 T G 2: 85,045,339 probably benign Het
Suco T A 1: 161,835,183 K560* probably null Het
Tbx3 T C 5: 119,680,953 V531A probably benign Het
Tmem30c T C 16: 57,277,737 Y107C probably damaging Het
Topbp1 T A 9: 103,311,764 probably null Het
Trpm5 A T 7: 143,088,951 D86E probably damaging Het
Urb2 C T 8: 124,028,561 Q336* probably null Het
Vmn2r43 A G 7: 8,244,971 F731S probably damaging Het
Xkr9 A G 1: 13,684,135 T118A probably benign Het
Zcchc2 A C 1: 106,019,879 K117N probably damaging Het
Zfp52 T C 17: 21,560,471 Y194H probably damaging Het
Zfp763 C T 17: 33,018,701 C490Y possibly damaging Het
Zmynd19 G T 2: 24,958,119 R148L possibly damaging Het
Other mutations in Olfr771
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02341:Olfr771 APN 10 129160433 missense probably benign 0.30
IGL02366:Olfr771 APN 10 129160625 missense probably damaging 1.00
IGL02947:Olfr771 APN 10 129160570 missense probably damaging 1.00
R0040:Olfr771 UTSW 10 129160739 missense probably benign 0.10
R0081:Olfr771 UTSW 10 129160838 missense possibly damaging 0.55
R1179:Olfr771 UTSW 10 129160058 missense probably benign 0.00
R1328:Olfr771 UTSW 10 129160424 missense possibly damaging 0.54
R1701:Olfr771 UTSW 10 129160105 missense probably damaging 1.00
R4470:Olfr771 UTSW 10 129160514 missense probably benign 0.16
R4814:Olfr771 UTSW 10 129160376 missense possibly damaging 0.77
R5106:Olfr771 UTSW 10 129160237 missense probably damaging 0.99
R5109:Olfr771 UTSW 10 129160237 missense probably damaging 0.99
R5209:Olfr771 UTSW 10 129160932 missense possibly damaging 0.74
R5646:Olfr771 UTSW 10 129160837 missense possibly damaging 0.55
R6114:Olfr771 UTSW 10 129160333 missense probably benign
R6879:Olfr771 UTSW 10 129160979 missense probably benign 0.04
R7358:Olfr771 UTSW 10 129160070 missense probably benign
R7426:Olfr771 UTSW 10 129160751 missense possibly damaging 0.67
R7699:Olfr771 UTSW 10 129160055 missense probably benign
R7700:Olfr771 UTSW 10 129160055 missense probably benign
Predicted Primers PCR Primer
(F):5'- GATTGACCTGTCTCCGGTTG -3'
(R):5'- TCTTCCACTTGCAGAAGAAACTAC -3'

Sequencing Primer
(F):5'- CCGGTTGCTATGTTGTACAAATATCG -3'
(R):5'- ACTATAACATTCACTGTTTACCGC -3'
Posted On2017-10-10