Mutagenetix > Incidental Mutations

Incidental Mutation 'R6133:Lrfn5'

487247

Institutional Source

Beutler Lab

Gene Symbol

Lrfn5

Ensembl Gene

ENSMUSG00000035653

Gene Name

leucine rich repeat and fibronectin type III domain containing 5

Synonyms

MMRRC Submission

044280-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.101) question?

Stock #

R6133 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

61523150-61858342 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 61843788 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 621 (D621G)

Ref Sequence

ENSEMBL: ENSMUSP00000113123 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055815] [ENSMUST00000119481]

Predicted Effect

probably benign
Transcript: ENSMUST00000055815
AA Change: D621G

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000051546
Gene: ENSMUSG00000035653
AA Change: D621G

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
LRRNT	19	55	1.11e1	SMART
LRR	74	97	3.07e-1	SMART
LRR_TYP	98	121	1.2e-3	SMART
LRR_TYP	122	145	8.94e-3	SMART
LRR	146	169	6.58e0	SMART
LRR_TYP	170	193	8.34e-3	SMART
LRR	194	218	2.47e1	SMART
LRRCT	240	285	1.65e-2	SMART
IGc2	299	364	3.53e-13	SMART
low complexity region	393	412	N/A	INTRINSIC
Blast:FN3	414	495	2e-48	BLAST
transmembrane domain	528	550	N/A	INTRINSIC
low complexity region	613	627	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000119481
AA Change: D621G

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000113123
Gene: ENSMUSG00000035653
AA Change: D621G

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
LRRNT	19	55	1.11e1	SMART
LRR	74	97	3.07e-1	SMART
LRR_TYP	98	121	1.2e-3	SMART
LRR_TYP	122	145	8.94e-3	SMART
LRR	146	169	6.58e0	SMART
LRR_TYP	170	193	8.34e-3	SMART
LRR	194	218	2.47e1	SMART
LRRCT	240	285	1.65e-2	SMART
IGc2	299	364	3.53e-13	SMART
low complexity region	393	412	N/A	INTRINSIC
Blast:FN3	414	495	2e-48	BLAST
transmembrane domain	528	550	N/A	INTRINSIC
low complexity region	613	627	N/A	INTRINSIC

Meta Mutation Damage Score

0.0692

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.2%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the leucine-rich repeat and fibronectin type III domain-containing family of proteins. A similar protein in mouse, a glycosylated transmembrane protein, is thought to function in presynaptic differentiation. [provided by RefSeq, Sep 2016]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy7	A	G	8: 88,325,439	T912A	possibly damaging	Het
Akap12	G	T	10: 4,355,178	G663C	probably benign	Het
Akap2	C	T	4: 57,855,516	Q525*	probably null	Het
Ankhd1	T	C	18: 36,625,126	S958P	possibly damaging	Het
Cmtm2a	T	C	8: 104,292,730	I76V	probably benign	Het
Cpxm2	G	A	7: 132,128,453	P146S	probably damaging	Het
Cubn	A	G	2: 13,308,618	V3047A	probably benign	Het
Dgkd	T	A	1: 87,938,240	V198E	possibly damaging	Het
Dnah3	A	T	7: 120,086,246	M181K	probably benign	Het
Dnah7a	T	C	1: 53,419,655	T3775A	probably benign	Het
Dsg2	A	G	18: 20,590,089	I391V	probably benign	Het
Ebi3	T	A	17: 55,954,311	V69E	probably benign	Het
Fn1	T	C	1: 71,597,727	T1998A	probably damaging	Het
Frmpd1	T	A	4: 45,284,915	H1245Q	probably benign	Het
Gm7145	T	A	1: 117,985,888	C167S	probably damaging	Het
Hydin	C	T	8: 110,601,276	T4805I	probably benign	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Kcnma1	C	T	14: 24,003,868	M21I	probably damaging	Het
Lrrc15	C	T	16: 30,274,236	G95D	probably benign	Het
Mex3d	A	G	10: 80,386,786	L212P	probably damaging	Het
Mmel1	C	T	4: 154,895,018	H728Y	probably damaging	Het
Naip1	A	G	13: 100,444,643	V32A	probably benign	Het
Nsl1	T	C	1: 191,071,206	L158P	probably damaging	Het
Olfr638	A	T	7: 104,003,325	T17S	possibly damaging	Het
Olfr771	G	A	10: 129,160,883	L34F	possibly damaging	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
Pcdh15	A	T	10: 74,645,973		probably null	Het
Pramef20	T	C	4: 144,377,777	R53G	possibly damaging	Het
Ptpn1	T	C	2: 167,967,796	V108A	possibly damaging	Het
Rad9b	T	C	5: 122,339,768	N182D	possibly damaging	Het
Rp1l1	C	T	14: 64,030,096	P1044S	probably damaging	Het
Scn2a	G	A	2: 65,743,104	V1433I	probably benign	Het
Ssrp1	T	G	2: 85,045,339		probably benign	Het
Suco	T	A	1: 161,835,183	K560*	probably null	Het
Tbx3	T	C	5: 119,680,953	V531A	probably benign	Het
Tmem30c	T	C	16: 57,277,737	Y107C	probably damaging	Het
Topbp1	T	A	9: 103,311,764		probably null	Het
Trpm5	A	T	7: 143,088,951	D86E	probably damaging	Het
Urb2	C	T	8: 124,028,561	Q336*	probably null	Het
Vmn2r43	A	G	7: 8,244,971	F731S	probably damaging	Het
Xkr9	A	G	1: 13,684,135	T118A	probably benign	Het
Zcchc2	A	C	1: 106,019,879	K117N	probably damaging	Het
Zfp52	T	C	17: 21,560,471	Y194H	probably damaging	Het
Zfp763	C	T	17: 33,018,701	C490Y	possibly damaging	Het
Zmynd19	G	T	2: 24,958,119	R148L	possibly damaging	Het

Other mutations in Lrfn5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00492:Lrfn5	APN	12	61844126	missense	probably benign
IGL02010:Lrfn5	APN	12	61839683	missense	probably damaging	0.96
IGL03033:Lrfn5	APN	12	61840047	missense	probably damaging	1.00
IGL03094:Lrfn5	APN	12	61839746	missense	probably benign	0.00
IGL03207:Lrfn5	APN	12	61843326	missense	probably damaging	1.00
falstaffian	UTSW	12	61843562	missense	probably benign	0.21
PIT4696001:Lrfn5	UTSW	12	61843557	missense	probably damaging	1.00
R0402:Lrfn5	UTSW	12	61840017	missense	probably benign	0.22
R0738:Lrfn5	UTSW	12	61840592	nonsense	probably null
R0744:Lrfn5	UTSW	12	61839668	missense	probably damaging	1.00
R0833:Lrfn5	UTSW	12	61839668	missense	probably damaging	1.00
R0973:Lrfn5	UTSW	12	61843437	missense	probably damaging	1.00
R0973:Lrfn5	UTSW	12	61843437	missense	probably damaging	1.00
R0974:Lrfn5	UTSW	12	61843437	missense	probably damaging	1.00
R1073:Lrfn5	UTSW	12	61840809	missense	probably damaging	1.00
R1332:Lrfn5	UTSW	12	61857528	splice site	probably benign
R1500:Lrfn5	UTSW	12	61839741	missense	probably damaging	1.00
R2039:Lrfn5	UTSW	12	61840323	missense	possibly damaging	0.82
R3834:Lrfn5	UTSW	12	61840030	missense	probably damaging	1.00
R4171:Lrfn5	UTSW	12	61843382	missense	probably damaging	1.00
R4212:Lrfn5	UTSW	12	61843820	missense	probably benign
R4394:Lrfn5	UTSW	12	61843490	missense	probably damaging	1.00
R4578:Lrfn5	UTSW	12	61843977	missense	probably benign
R4661:Lrfn5	UTSW	12	61839647	missense	probably damaging	1.00
R4730:Lrfn5	UTSW	12	61840719	missense	probably benign	0.03
R4955:Lrfn5	UTSW	12	61839978	missense	probably benign	0.29
R4968:Lrfn5	UTSW	12	61839675	missense	probably damaging	1.00
R4970:Lrfn5	UTSW	12	61839675	missense	probably damaging	1.00
R5078:Lrfn5	UTSW	12	61843874	missense	possibly damaging	0.47
R5165:Lrfn5	UTSW	12	61839624	missense	possibly damaging	0.89
R5768:Lrfn5	UTSW	12	61839723	missense	probably benign	0.44
R5892:Lrfn5	UTSW	12	61843418	missense	probably damaging	1.00
R6211:Lrfn5	UTSW	12	61839470	missense	probably benign	0.00
R6297:Lrfn5	UTSW	12	61843562	missense	probably benign	0.21
R6341:Lrfn5	UTSW	12	61843582	nonsense	probably null
R6861:Lrfn5	UTSW	12	61839690	missense	probably damaging	1.00
R7179:Lrfn5	UTSW	12	61843982	missense	probably benign
R7392:Lrfn5	UTSW	12	61840304	missense	probably benign	0.00
Z1177:Lrfn5	UTSW	12	61839817	missense	not run

Predicted Primers

PCR Primer
(F):5'- TAATGGGCAACACAAGGTCAC -3'
(R):5'- TGGGCCCCTCTGTAACAGAATC -3'

Sequencing Primer
(F):5'- CGAAGGTTAGCAACGTTTATTCTCAG -3'
(R):5'- CCCTCTGTAACAGAATCAGGAGG -3'

Posted On

2017-10-10