Mutagenetix > Incidental Mutations

Incidental Mutation 'R6133:Kcnma1'

487249

Institutional Source

Beutler Lab

Gene Symbol

Kcnma1

Ensembl Gene

ENSMUSG00000063142

Gene Name

potassium large conductance calcium-activated channel, subfamily M, alpha member 1

Synonyms

mSlo1, MaxiK, Slo1, 5730414M22Rik, BK channel alpha subunit, BKCa, Slo

MMRRC Submission

044280-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.821) question?

Stock #

R6133 (G1)

Quality Score

94.0249

Status

Validated

Chromosome

Chromosomal Location

23289431-24014491 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 24003868 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 21 (M21I)

Ref Sequence

ENSEMBL: ENSMUSP00000153083 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000145596] [ENSMUST00000188210] [ENSMUST00000188285] [ENSMUST00000188991] [ENSMUST00000190044] [ENSMUST00000190339] [ENSMUST00000190985] [ENSMUST00000223655] [ENSMUST00000223727] [ENSMUST00000223749] [ENSMUST00000224077] [ENSMUST00000224232] [ENSMUST00000224285] [ENSMUST00000224468] [ENSMUST00000224787] [ENSMUST00000224812] [ENSMUST00000225315] [ENSMUST00000225431] [ENSMUST00000225471] [ENSMUST00000225556] [ENSMUST00000225794] [ENSMUST00000226051]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000145596
AA Change: M86I

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000188210
AA Change: M21I

PolyPhen 2 Score 0.486 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000141069
Gene: ENSMUSG00000063142
AA Change: M21I

Domain	Start	End	E-Value	Type
low complexity region	4	23	N/A	INTRINSIC
transmembrane domain	86	108	N/A	INTRINSIC
low complexity region	145	156	N/A	INTRINSIC
transmembrane domain	179	198	N/A	INTRINSIC
Pfam:Ion_trans	216	387	1.3e-18	PFAM
Pfam:Ion_trans_2	305	393	5.2e-16	PFAM
Pfam:TrkA_N	439	538	7.8e-7	PFAM
Pfam:BK_channel_a	536	634	5e-31	PFAM
low complexity region	988	996	N/A	INTRINSIC
low complexity region	1044	1055	N/A	INTRINSIC
low complexity region	1158	1184	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000188285
AA Change: M86I

PolyPhen 2 Score 0.467 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000140275
Gene: ENSMUSG00000063142
AA Change: M86I

Domain	Start	End	E-Value	Type
low complexity region	4	23	N/A	INTRINSIC
transmembrane domain	86	108	N/A	INTRINSIC
low complexity region	145	156	N/A	INTRINSIC
transmembrane domain	179	198	N/A	INTRINSIC
Pfam:Ion_trans	216	387	1.3e-18	PFAM
Pfam:Ion_trans_2	305	393	5.4e-16	PFAM
Pfam:TrkA_N	439	538	8e-7	PFAM
Pfam:BK_channel_a	536	634	5.2e-31	PFAM
low complexity region	1019	1027	N/A	INTRINSIC
low complexity region	1075	1086	N/A	INTRINSIC
low complexity region	1189	1215	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000188991
AA Change: M86I

PolyPhen 2 Score 0.467 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000140751
Gene: ENSMUSG00000063142
AA Change: M86I

Domain	Start	End	E-Value	Type
low complexity region	4	23	N/A	INTRINSIC
transmembrane domain	86	108	N/A	INTRINSIC
low complexity region	145	156	N/A	INTRINSIC
transmembrane domain	179	198	N/A	INTRINSIC
Pfam:Ion_trans	216	387	3.3e-18	PFAM
Pfam:Ion_trans_2	305	393	1.1e-15	PFAM
Pfam:TrkA_N	439	538	3.7e-7	PFAM
Pfam:BK_channel_a	536	634	3.4e-31	PFAM
low complexity region	1015	1023	N/A	INTRINSIC
low complexity region	1071	1082	N/A	INTRINSIC
low complexity region	1185	1211	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000190044
AA Change: M86I

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000140033
Gene: ENSMUSG00000063142
AA Change: M86I

Domain	Start	End	E-Value	Type
low complexity region	4	23	N/A	INTRINSIC
transmembrane domain	86	108	N/A	INTRINSIC
low complexity region	145	156	N/A	INTRINSIC
transmembrane domain	179	198	N/A	INTRINSIC
Pfam:Ion_trans	216	387	1.3e-18	PFAM
Pfam:Ion_trans_2	305	393	5.1e-16	PFAM
Pfam:TrkA_N	439	538	7.5e-7	PFAM
Pfam:BK_channel_a	536	634	4.9e-31	PFAM
low complexity region	957	965	N/A	INTRINSIC
low complexity region	1013	1024	N/A	INTRINSIC
low complexity region	1127	1153	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000190339
AA Change: M86I

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000141143
Gene: ENSMUSG00000063142
AA Change: M86I

Domain	Start	End	E-Value	Type
low complexity region	4	23	N/A	INTRINSIC
transmembrane domain	86	108	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000190985
AA Change: M21I

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223609

Predicted Effect

possibly damaging
Transcript: ENSMUST00000223655
AA Change: M21I

PolyPhen 2 Score 0.806 (Sensitivity: 0.84; Specificity: 0.93)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000223727
AA Change: M21I

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000223749
AA Change: M21I

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223837

Predicted Effect

unknown
Transcript: ENSMUST00000224025
AA Change: M36I

Predicted Effect

possibly damaging
Transcript: ENSMUST00000224077
AA Change: M21I

PolyPhen 2 Score 0.806 (Sensitivity: 0.84; Specificity: 0.93)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000224232
AA Change: M21I

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000224285
AA Change: M21I

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000224468
AA Change: M86I

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000224787
AA Change: M21I

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

Predicted Effect

probably damaging
Transcript: ENSMUST00000224812
AA Change: M21I

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

Predicted Effect

probably damaging
Transcript: ENSMUST00000225315
AA Change: M21I

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

Predicted Effect

probably damaging
Transcript: ENSMUST00000225431
AA Change: M21I

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

Predicted Effect

probably damaging
Transcript: ENSMUST00000225471
AA Change: M21I

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000225556
AA Change: M21I

PolyPhen 2 Score 0.806 (Sensitivity: 0.84; Specificity: 0.93)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000225794
AA Change: M21I

PolyPhen 2 Score 0.501 (Sensitivity: 0.88; Specificity: 0.90)

Predicted Effect

probably benign
Transcript: ENSMUST00000226051

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.2%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MaxiK channels are large conductance, voltage and calcium-sensitive potassium channels which are fundamental to the control of smooth muscle tone and neuronal excitability. MaxiK channels can be formed by 2 subunits: the pore-forming alpha subunit, which is the product of this gene, and the modulatory beta subunit. Intracellular calcium regulates the physical association between the alpha and beta subunits. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to cerebellar ataxia, Purkinje cell dysfunction, uneven gait patterns, bladder hyperactivity, urinary incontinence, abnormal colonic K+ secretion, and hearing impairment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy7	A	G	8: 88,325,439	T912A	possibly damaging	Het
Akap12	G	T	10: 4,355,178	G663C	probably benign	Het
Akap2	C	T	4: 57,855,516	Q525*	probably null	Het
Ankhd1	T	C	18: 36,625,126	S958P	possibly damaging	Het
Cmtm2a	T	C	8: 104,292,730	I76V	probably benign	Het
Cpxm2	G	A	7: 132,128,453	P146S	probably damaging	Het
Cubn	A	G	2: 13,308,618	V3047A	probably benign	Het
Dgkd	T	A	1: 87,938,240	V198E	possibly damaging	Het
Dnah3	A	T	7: 120,086,246	M181K	probably benign	Het
Dnah7a	T	C	1: 53,419,655	T3775A	probably benign	Het
Dsg2	A	G	18: 20,590,089	I391V	probably benign	Het
Ebi3	T	A	17: 55,954,311	V69E	probably benign	Het
Fn1	T	C	1: 71,597,727	T1998A	probably damaging	Het
Frmpd1	T	A	4: 45,284,915	H1245Q	probably benign	Het
Gm7145	T	A	1: 117,985,888	C167S	probably damaging	Het
Hydin	C	T	8: 110,601,276	T4805I	probably benign	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Lrfn5	A	G	12: 61,843,788	D621G	probably benign	Het
Lrrc15	C	T	16: 30,274,236	G95D	probably benign	Het
Mex3d	A	G	10: 80,386,786	L212P	probably damaging	Het
Mmel1	C	T	4: 154,895,018	H728Y	probably damaging	Het
Naip1	A	G	13: 100,444,643	V32A	probably benign	Het
Nsl1	T	C	1: 191,071,206	L158P	probably damaging	Het
Olfr638	A	T	7: 104,003,325	T17S	possibly damaging	Het
Olfr771	G	A	10: 129,160,883	L34F	possibly damaging	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
Pcdh15	A	T	10: 74,645,973		probably null	Het
Pramef20	T	C	4: 144,377,777	R53G	possibly damaging	Het
Ptpn1	T	C	2: 167,967,796	V108A	possibly damaging	Het
Rad9b	T	C	5: 122,339,768	N182D	possibly damaging	Het
Rp1l1	C	T	14: 64,030,096	P1044S	probably damaging	Het
Scn2a	G	A	2: 65,743,104	V1433I	probably benign	Het
Ssrp1	T	G	2: 85,045,339		probably benign	Het
Suco	T	A	1: 161,835,183	K560*	probably null	Het
Tbx3	T	C	5: 119,680,953	V531A	probably benign	Het
Tmem30c	T	C	16: 57,277,737	Y107C	probably damaging	Het
Topbp1	T	A	9: 103,311,764		probably null	Het
Trpm5	A	T	7: 143,088,951	D86E	probably damaging	Het
Urb2	C	T	8: 124,028,561	Q336*	probably null	Het
Vmn2r43	A	G	7: 8,244,971	F731S	probably damaging	Het
Xkr9	A	G	1: 13,684,135	T118A	probably benign	Het
Zcchc2	A	C	1: 106,019,879	K117N	probably damaging	Het
Zfp52	T	C	17: 21,560,471	Y194H	probably damaging	Het
Zfp763	C	T	17: 33,018,701	C490Y	possibly damaging	Het
Zmynd19	G	T	2: 24,958,119	R148L	possibly damaging	Het

Other mutations in Kcnma1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01318:Kcnma1	APN	14	23314322	splice site	probably benign
IGL01520:Kcnma1	APN	14	23501143	missense	possibly damaging	0.94
IGL01977:Kcnma1	APN	14	23530299	splice site	probably benign
IGL02140:Kcnma1	APN	14	23309045	missense	probably damaging	1.00
IGL02165:Kcnma1	APN	14	23336967	missense	possibly damaging	0.93
IGL02186:Kcnma1	APN	14	23526813	missense	probably benign	0.28
IGL02268:Kcnma1	APN	14	23543076	missense	probably damaging	1.00
IGL02353:Kcnma1	APN	14	23591613	missense	probably damaging	1.00
IGL02360:Kcnma1	APN	14	23591613	missense	probably damaging	1.00
IGL02491:Kcnma1	APN	14	23311689	missense	probably damaging	1.00
IGL02552:Kcnma1	APN	14	23386259	critical splice donor site	probably null
IGL02625:Kcnma1	APN	14	23363832	missense	probably damaging	1.00
IGL02677:Kcnma1	APN	14	23463156	missense	probably damaging	1.00
IGL02706:Kcnma1	APN	14	23309154	missense	probably damaging	1.00
PIT4495001:Kcnma1	UTSW	14	23425597	missense	probably benign	0.00
PIT4514001:Kcnma1	UTSW	14	23309035	splice site	probably null
PIT4576001:Kcnma1	UTSW	14	23309035	splice site	probably null
R0071:Kcnma1	UTSW	14	23526767	missense	probably damaging	1.00
R0071:Kcnma1	UTSW	14	23526767	missense	probably damaging	1.00
R0115:Kcnma1	UTSW	14	23314175	missense	probably damaging	1.00
R0172:Kcnma1	UTSW	14	23803166	missense	probably damaging	1.00
R0178:Kcnma1	UTSW	14	23526767	missense	probably damaging	1.00
R0183:Kcnma1	UTSW	14	23508052	missense	probably damaging	1.00
R0240:Kcnma1	UTSW	14	23494579	missense	probably damaging	1.00
R0240:Kcnma1	UTSW	14	23494579	missense	probably damaging	1.00
R0328:Kcnma1	UTSW	14	23373197	missense	probably damaging	1.00
R0501:Kcnma1	UTSW	14	23311716	missense	possibly damaging	0.80
R0631:Kcnma1	UTSW	14	23509784	splice site	probably benign
R0668:Kcnma1	UTSW	14	23367495	missense	probably damaging	1.00
R0811:Kcnma1	UTSW	14	23300018	missense	probably damaging	0.96
R0812:Kcnma1	UTSW	14	23300018	missense	probably damaging	0.96
R1080:Kcnma1	UTSW	14	23494607	missense	probably damaging	1.00
R1419:Kcnma1	UTSW	14	23367642	missense	probably damaging	0.99
R1446:Kcnma1	UTSW	14	23311724	missense	probably damaging	1.00
R1454:Kcnma1	UTSW	14	23463200	missense	probably damaging	1.00
R1651:Kcnma1	UTSW	14	23314194	missense	probably damaging	1.00
R1826:Kcnma1	UTSW	14	23330929	missense	probably damaging	1.00
R1827:Kcnma1	UTSW	14	23330929	missense	probably damaging	1.00
R1828:Kcnma1	UTSW	14	23330929	missense	probably damaging	1.00
R1864:Kcnma1	UTSW	14	23803162	missense	probably damaging	1.00
R2002:Kcnma1	UTSW	14	23337029	missense	probably damaging	0.99
R2140:Kcnma1	UTSW	14	23314220	missense	probably damaging	1.00
R2278:Kcnma1	UTSW	14	23543083	nonsense	probably null
R2866:Kcnma1	UTSW	14	23373207	missense	probably benign	0.16
R2867:Kcnma1	UTSW	14	23373207	missense	probably benign	0.16
R2867:Kcnma1	UTSW	14	23373207	missense	probably benign	0.16
R2900:Kcnma1	UTSW	14	23803160	missense	probably damaging	1.00
R3820:Kcnma1	UTSW	14	23299938	missense	possibly damaging	0.66
R3821:Kcnma1	UTSW	14	23367611	missense	probably damaging	1.00
R3901:Kcnma1	UTSW	14	23505255	missense	probably damaging	0.98
R3975:Kcnma1	UTSW	14	24003747	critical splice donor site	probably null
R3976:Kcnma1	UTSW	14	24003747	critical splice donor site	probably null
R4352:Kcnma1	UTSW	14	23311652	missense	probably damaging	1.00
R4517:Kcnma1	UTSW	14	23337029	missense	probably damaging	1.00
R4598:Kcnma1	UTSW	14	23803160	missense	probably damaging	1.00
R4604:Kcnma1	UTSW	14	23309038	critical splice donor site	probably null
R4743:Kcnma1	UTSW	14	23803202	missense	probably damaging	1.00
R4754:Kcnma1	UTSW	14	23363836	missense	probably damaging	0.96
R4908:Kcnma1	UTSW	14	23309152	missense	probably damaging	0.99
R4960:Kcnma1	UTSW	14	24004118	intron	probably benign
R5175:Kcnma1	UTSW	14	23336038	critical splice donor site	probably null
R5218:Kcnma1	UTSW	14	23463185	missense	probably damaging	0.96
R5435:Kcnma1	UTSW	14	23528404	nonsense	probably null
R5705:Kcnma1	UTSW	14	24003771	missense	possibly damaging	0.73
R5746:Kcnma1	UTSW	14	23494567	missense	probably damaging	1.00
R5780:Kcnma1	UTSW	14	23386351	nonsense	probably null
R5793:Kcnma1	UTSW	14	23309035	splice site	probably null
R6039:Kcnma1	UTSW	14	23309037	missense	probably benign	0.42
R6039:Kcnma1	UTSW	14	23309037	missense	probably benign	0.42
R6271:Kcnma1	UTSW	14	23509889	missense	probably damaging	1.00
R6490:Kcnma1	UTSW	14	23336097	missense	possibly damaging	0.46
R6704:Kcnma1	UTSW	14	24002814	nonsense	probably null
R6822:Kcnma1	UTSW	14	24003744	splice site	probably null
R6855:Kcnma1	UTSW	14	23367611	missense	probably damaging	1.00
R6920:Kcnma1	UTSW	14	23526534	critical splice donor site	probably null
R7017:Kcnma1	UTSW	14	23494643	missense	possibly damaging	0.79
R7081:Kcnma1	UTSW	14	23300018	missense	probably damaging	0.96
R7113:Kcnma1	UTSW	14	23463156	missense	probably damaging	1.00
R7131:Kcnma1	UTSW	14	23367494	missense	probably damaging	1.00
R7172:Kcnma1	UTSW	14	23526623	missense	probably damaging	1.00
R7207:Kcnma1	UTSW	14	23309015	makesense	probably null
R7308:Kcnma1	UTSW	14	23330935	missense	probably damaging	0.99
R7371:Kcnma1	UTSW	14	23494570	missense	possibly damaging	0.94
R7404:Kcnma1	UTSW	14	24002834	missense	unknown
R7560:Kcnma1	UTSW	14	23530242	missense	probably benign	0.15
R7693:Kcnma1	UTSW	14	23367612	missense	probably damaging	1.00
R7763:Kcnma1	UTSW	14	23300006	missense	possibly damaging	0.66
R7809:Kcnma1	UTSW	14	23373256	missense	probably benign	0.16
R7832:Kcnma1	UTSW	14	23390923	missense	probably benign
R7884:Kcnma1	UTSW	14	23336989	missense	probably benign	0.01
R7915:Kcnma1	UTSW	14	23390923	missense	probably benign
R7967:Kcnma1	UTSW	14	23336989	missense	probably benign	0.01
RF001:Kcnma1	UTSW	14	23311697	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCCATAGTCACCAATAGCC -3'
(R):5'- TGAGCAGCAATATCCACGCG -3'

Sequencing Primer
(F):5'- TGCTGGGGTCAACTCCTCAC -3'
(R):5'- GCGAACCATCTCAGCCTAG -3'

Posted On

2017-10-10