Mutagenetix > Incidental Mutations

Incidental Mutation 'R6133:Rp1l1'

487250

Institutional Source

Beutler Lab

Gene Symbol

Rp1l1

Ensembl Gene

ENSMUSG00000046049

Gene Name

retinitis pigmentosa 1 homolog like 1

Synonyms

Dcdc4, Rp1hl1

MMRRC Submission

044280-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.097) question?

Stock #

R6133 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

63992506-64035025 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 64030096 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 1044 (P1044S)

Ref Sequence

ENSEMBL: ENSMUSP00000055449 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058229]

Predicted Effect

probably damaging
Transcript: ENSMUST00000058229
AA Change: P1044S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000055449
Gene: ENSMUSG00000046049
AA Change: P1044S

Domain	Start	End	E-Value	Type
low complexity region	11	21	N/A	INTRINSIC
DCX	37	121	1.58e-13	SMART
DCX	155	239	1e-15	SMART
low complexity region	709	728	N/A	INTRINSIC
low complexity region	870	884	N/A	INTRINSIC
low complexity region	1159	1177	N/A	INTRINSIC
low complexity region	1228	1239	N/A	INTRINSIC
low complexity region	1612	1618	N/A	INTRINSIC
low complexity region	1642	1652	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224314

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.2%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: This gene encodes a member of the doublecortin family. This protein is a retinal-specific protein. It contains two N-terminal doublecortin domains, which can assemble and stabilize axonemal microtubules, but lacks the C-terminal repetitive regions including the 16aa repeat found in human RP1L1. This protein and the RP1 protein, another retinal-specific protein, play essential and synergistic roles in affecting photosensitivity and outer segment morphogenesis of rod photoreceptors. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit retinal photoreceptor abnormalities, including scattered outer segment disorganization, reduced electroretinogram amplitudes, and progressive retinal rod cell degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy7	A	G	8: 88,325,439	T912A	possibly damaging	Het
Akap12	G	T	10: 4,355,178	G663C	probably benign	Het
Akap2	C	T	4: 57,855,516	Q525*	probably null	Het
Ankhd1	T	C	18: 36,625,126	S958P	possibly damaging	Het
Cmtm2a	T	C	8: 104,292,730	I76V	probably benign	Het
Cpxm2	G	A	7: 132,128,453	P146S	probably damaging	Het
Cubn	A	G	2: 13,308,618	V3047A	probably benign	Het
Dgkd	T	A	1: 87,938,240	V198E	possibly damaging	Het
Dnah3	A	T	7: 120,086,246	M181K	probably benign	Het
Dnah7a	T	C	1: 53,419,655	T3775A	probably benign	Het
Dsg2	A	G	18: 20,590,089	I391V	probably benign	Het
Ebi3	T	A	17: 55,954,311	V69E	probably benign	Het
Fn1	T	C	1: 71,597,727	T1998A	probably damaging	Het
Frmpd1	T	A	4: 45,284,915	H1245Q	probably benign	Het
Gm7145	T	A	1: 117,985,888	C167S	probably damaging	Het
Hydin	C	T	8: 110,601,276	T4805I	probably benign	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Kcnma1	C	T	14: 24,003,868	M21I	probably damaging	Het
Lrfn5	A	G	12: 61,843,788	D621G	probably benign	Het
Lrrc15	C	T	16: 30,274,236	G95D	probably benign	Het
Mex3d	A	G	10: 80,386,786	L212P	probably damaging	Het
Mmel1	C	T	4: 154,895,018	H728Y	probably damaging	Het
Naip1	A	G	13: 100,444,643	V32A	probably benign	Het
Nsl1	T	C	1: 191,071,206	L158P	probably damaging	Het
Olfr638	A	T	7: 104,003,325	T17S	possibly damaging	Het
Olfr771	G	A	10: 129,160,883	L34F	possibly damaging	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
Pcdh15	A	T	10: 74,645,973		probably null	Het
Pramef20	T	C	4: 144,377,777	R53G	possibly damaging	Het
Ptpn1	T	C	2: 167,967,796	V108A	possibly damaging	Het
Rad9b	T	C	5: 122,339,768	N182D	possibly damaging	Het
Scn2a	G	A	2: 65,743,104	V1433I	probably benign	Het
Ssrp1	T	G	2: 85,045,339		probably benign	Het
Suco	T	A	1: 161,835,183	K560*	probably null	Het
Tbx3	T	C	5: 119,680,953	V531A	probably benign	Het
Tmem30c	T	C	16: 57,277,737	Y107C	probably damaging	Het
Topbp1	T	A	9: 103,311,764		probably null	Het
Trpm5	A	T	7: 143,088,951	D86E	probably damaging	Het
Urb2	C	T	8: 124,028,561	Q336*	probably null	Het
Vmn2r43	A	G	7: 8,244,971	F731S	probably damaging	Het
Xkr9	A	G	1: 13,684,135	T118A	probably benign	Het
Zcchc2	A	C	1: 106,019,879	K117N	probably damaging	Het
Zfp52	T	C	17: 21,560,471	Y194H	probably damaging	Het
Zfp763	C	T	17: 33,018,701	C490Y	possibly damaging	Het
Zmynd19	G	T	2: 24,958,119	R148L	possibly damaging	Het

Other mutations in Rp1l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00494:Rp1l1	APN	14	64028725	missense	probably benign	0.01
IGL02063:Rp1l1	APN	14	64029536	missense	probably damaging	0.99
IGL02132:Rp1l1	APN	14	64028810	missense	probably benign
IGL02430:Rp1l1	APN	14	64029286	missense	probably benign	0.00
IGL02977:Rp1l1	APN	14	64028150	missense	probably benign	0.01
IGL03213:Rp1l1	APN	14	64028415	missense	probably damaging	0.98
IGL03346:Rp1l1	APN	14	64029440	missense	probably benign
R0085:Rp1l1	UTSW	14	64022295	missense	probably damaging	0.99
R0347:Rp1l1	UTSW	14	64030804	nonsense	probably null
R0362:Rp1l1	UTSW	14	64031066	nonsense	probably null
R0369:Rp1l1	UTSW	14	64029388	missense	possibly damaging	0.84
R0538:Rp1l1	UTSW	14	64022092	missense	probably damaging	1.00
R0544:Rp1l1	UTSW	14	64032066	missense	probably benign	0.00
R0780:Rp1l1	UTSW	14	64030351	missense	possibly damaging	0.94
R0944:Rp1l1	UTSW	14	64032232	missense	probably benign	0.05
R1051:Rp1l1	UTSW	14	64032535	missense	probably damaging	0.99
R1126:Rp1l1	UTSW	14	64030469	missense	probably damaging	1.00
R1450:Rp1l1	UTSW	14	64028150	missense	probably benign	0.01
R1483:Rp1l1	UTSW	14	64029047	missense	possibly damaging	0.76
R1508:Rp1l1	UTSW	14	64030892	missense	possibly damaging	0.83
R1553:Rp1l1	UTSW	14	64031894	missense	probably benign	0.00
R1651:Rp1l1	UTSW	14	64030993	missense	probably damaging	0.97
R1682:Rp1l1	UTSW	14	64028968	missense	probably damaging	0.98
R1809:Rp1l1	UTSW	14	64027966	missense	probably benign	0.18
R1885:Rp1l1	UTSW	14	64028390	missense	probably benign	0.01
R1887:Rp1l1	UTSW	14	64028390	missense	probably benign	0.01
R1898:Rp1l1	UTSW	14	64031590	missense	probably benign	0.04
R1924:Rp1l1	UTSW	14	64031543	missense	probably benign
R1939:Rp1l1	UTSW	14	64029593	missense	probably benign
R1941:Rp1l1	UTSW	14	64022252	missense	probably damaging	1.00
R2129:Rp1l1	UTSW	14	64028966	missense	possibly damaging	0.93
R2363:Rp1l1	UTSW	14	64029998	missense	possibly damaging	0.55
R3894:Rp1l1	UTSW	14	64029307	missense	probably benign
R3974:Rp1l1	UTSW	14	64030309	missense	probably damaging	1.00
R3975:Rp1l1	UTSW	14	64030309	missense	probably damaging	1.00
R3976:Rp1l1	UTSW	14	64030309	missense	probably damaging	1.00
R4072:Rp1l1	UTSW	14	64028132	missense	probably damaging	1.00
R4672:Rp1l1	UTSW	14	64031270	missense	probably damaging	1.00
R4673:Rp1l1	UTSW	14	64031270	missense	probably damaging	1.00
R4749:Rp1l1	UTSW	14	64029800	missense	probably damaging	0.99
R4755:Rp1l1	UTSW	14	64030070	missense	probably benign	0.34
R4877:Rp1l1	UTSW	14	64026171	missense	probably benign	0.00
R4930:Rp1l1	UTSW	14	64032206	missense	probably benign
R5039:Rp1l1	UTSW	14	64031356	missense	probably benign	0.21
R5106:Rp1l1	UTSW	14	64027946	missense	probably damaging	1.00
R5184:Rp1l1	UTSW	14	64030180	missense	probably damaging	1.00
R5215:Rp1l1	UTSW	14	64030013	missense	probably benign	0.01
R5409:Rp1l1	UTSW	14	64030621	missense	probably benign	0.02
R5575:Rp1l1	UTSW	14	64030984	missense	probably benign	0.23
R5696:Rp1l1	UTSW	14	64029746	missense	probably damaging	0.99
R5739:Rp1l1	UTSW	14	64032170	missense	probably benign	0.01
R5878:Rp1l1	UTSW	14	64028906	missense	probably benign	0.09
R6134:Rp1l1	UTSW	14	64030096	missense	probably damaging	1.00
R6135:Rp1l1	UTSW	14	64030096	missense	probably damaging	1.00
R6428:Rp1l1	UTSW	14	64032389	missense	possibly damaging	0.92
R6594:Rp1l1	UTSW	14	64031677	nonsense	probably null
R6736:Rp1l1	UTSW	14	64029724	missense	possibly damaging	0.93
R6800:Rp1l1	UTSW	14	64031150	missense	possibly damaging	0.92
R6848:Rp1l1	UTSW	14	64028218	missense	possibly damaging	0.79
R6878:Rp1l1	UTSW	14	64031852	missense	probably benign	0.00
R6922:Rp1l1	UTSW	14	64030385	missense	possibly damaging	0.93
R6980:Rp1l1	UTSW	14	64028720	missense	probably benign	0.02
R7053:Rp1l1	UTSW	14	64031509	missense	possibly damaging	0.68
R7151:Rp1l1	UTSW	14	64029026	missense	possibly damaging	0.73
R7291:Rp1l1	UTSW	14	64032298	missense	probably benign	0.10
R7335:Rp1l1	UTSW	14	64031998	missense	probably benign	0.00
R7344:Rp1l1	UTSW	14	64029620	missense	probably benign	0.00
R7470:Rp1l1	UTSW	14	64028566	missense	probably benign
R7570:Rp1l1	UTSW	14	64031574	nonsense	probably null
R7585:Rp1l1	UTSW	14	64030139	missense	probably damaging	0.96
R7591:Rp1l1	UTSW	14	64026109	missense	probably damaging	1.00
R7667:Rp1l1	UTSW	14	64029803	missense	probably benign	0.04
R7862:Rp1l1	UTSW	14	64028027	missense	probably damaging	1.00
R7945:Rp1l1	UTSW	14	64028027	missense	probably damaging	1.00
X0057:Rp1l1	UTSW	14	64030040	missense	probably benign	0.14
X0063:Rp1l1	UTSW	14	64029223	missense	probably damaging	0.98
Z1088:Rp1l1	UTSW	14	64028758	missense	possibly damaging	0.80
Z1088:Rp1l1	UTSW	14	64030378	missense	probably benign	0.01
Z1176:Rp1l1	UTSW	14	64029144	missense	not run
Z1177:Rp1l1	UTSW	14	64032297	missense	not run

Predicted Primers

PCR Primer
(F):5'- AAGGGGCTACCAATGAGCAC -3'
(R):5'- AGAGTCTCAGCATCTCCTGG -3'

Sequencing Primer
(F):5'- GGCTACCAATGAGCACCCAGAG -3'
(R):5'- GTACTTAGGGGACTCTTCAAGCC -3'

Posted On

2017-10-10