Incidental Mutation 'R6133:Rp1l1'
ID487250
Institutional Source Beutler Lab
Gene Symbol Rp1l1
Ensembl Gene ENSMUSG00000046049
Gene Nameretinitis pigmentosa 1 homolog like 1
SynonymsDcdc4, Rp1hl1
MMRRC Submission 044280-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R6133 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location63992506-64035025 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 64030096 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 1044 (P1044S)
Ref Sequence ENSEMBL: ENSMUSP00000055449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058229]
Predicted Effect probably damaging
Transcript: ENSMUST00000058229
AA Change: P1044S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055449
Gene: ENSMUSG00000046049
AA Change: P1044S

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
DCX 37 121 1.58e-13 SMART
DCX 155 239 1e-15 SMART
low complexity region 709 728 N/A INTRINSIC
low complexity region 870 884 N/A INTRINSIC
low complexity region 1159 1177 N/A INTRINSIC
low complexity region 1228 1239 N/A INTRINSIC
low complexity region 1612 1618 N/A INTRINSIC
low complexity region 1642 1652 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224314
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: This gene encodes a member of the doublecortin family. This protein is a retinal-specific protein. It contains two N-terminal doublecortin domains, which can assemble and stabilize axonemal microtubules, but lacks the C-terminal repetitive regions including the 16aa repeat found in human RP1L1. This protein and the RP1 protein, another retinal-specific protein, play essential and synergistic roles in affecting photosensitivity and outer segment morphogenesis of rod photoreceptors. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit retinal photoreceptor abnormalities, including scattered outer segment disorganization, reduced electroretinogram amplitudes, and progressive retinal rod cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 A G 8: 88,325,439 T912A possibly damaging Het
Akap12 G T 10: 4,355,178 G663C probably benign Het
Akap2 C T 4: 57,855,516 Q525* probably null Het
Ankhd1 T C 18: 36,625,126 S958P possibly damaging Het
Cmtm2a T C 8: 104,292,730 I76V probably benign Het
Cpxm2 G A 7: 132,128,453 P146S probably damaging Het
Cubn A G 2: 13,308,618 V3047A probably benign Het
Dgkd T A 1: 87,938,240 V198E possibly damaging Het
Dnah3 A T 7: 120,086,246 M181K probably benign Het
Dnah7a T C 1: 53,419,655 T3775A probably benign Het
Dsg2 A G 18: 20,590,089 I391V probably benign Het
Ebi3 T A 17: 55,954,311 V69E probably benign Het
Fn1 T C 1: 71,597,727 T1998A probably damaging Het
Frmpd1 T A 4: 45,284,915 H1245Q probably benign Het
Gm7145 T A 1: 117,985,888 C167S probably damaging Het
Hydin C T 8: 110,601,276 T4805I probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnma1 C T 14: 24,003,868 M21I probably damaging Het
Lrfn5 A G 12: 61,843,788 D621G probably benign Het
Lrrc15 C T 16: 30,274,236 G95D probably benign Het
Mex3d A G 10: 80,386,786 L212P probably damaging Het
Mmel1 C T 4: 154,895,018 H728Y probably damaging Het
Naip1 A G 13: 100,444,643 V32A probably benign Het
Nsl1 T C 1: 191,071,206 L158P probably damaging Het
Olfr638 A T 7: 104,003,325 T17S possibly damaging Het
Olfr771 G A 10: 129,160,883 L34F possibly damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Pcdh15 A T 10: 74,645,973 probably null Het
Pramef20 T C 4: 144,377,777 R53G possibly damaging Het
Ptpn1 T C 2: 167,967,796 V108A possibly damaging Het
Rad9b T C 5: 122,339,768 N182D possibly damaging Het
Scn2a G A 2: 65,743,104 V1433I probably benign Het
Ssrp1 T G 2: 85,045,339 probably benign Het
Suco T A 1: 161,835,183 K560* probably null Het
Tbx3 T C 5: 119,680,953 V531A probably benign Het
Tmem30c T C 16: 57,277,737 Y107C probably damaging Het
Topbp1 T A 9: 103,311,764 probably null Het
Trpm5 A T 7: 143,088,951 D86E probably damaging Het
Urb2 C T 8: 124,028,561 Q336* probably null Het
Vmn2r43 A G 7: 8,244,971 F731S probably damaging Het
Xkr9 A G 1: 13,684,135 T118A probably benign Het
Zcchc2 A C 1: 106,019,879 K117N probably damaging Het
Zfp52 T C 17: 21,560,471 Y194H probably damaging Het
Zfp763 C T 17: 33,018,701 C490Y possibly damaging Het
Zmynd19 G T 2: 24,958,119 R148L possibly damaging Het
Other mutations in Rp1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Rp1l1 APN 14 64028725 missense probably benign 0.01
IGL02063:Rp1l1 APN 14 64029536 missense probably damaging 0.99
IGL02132:Rp1l1 APN 14 64028810 missense probably benign
IGL02430:Rp1l1 APN 14 64029286 missense probably benign 0.00
IGL02977:Rp1l1 APN 14 64028150 missense probably benign 0.01
IGL03213:Rp1l1 APN 14 64028415 missense probably damaging 0.98
IGL03346:Rp1l1 APN 14 64029440 missense probably benign
R0085:Rp1l1 UTSW 14 64022295 missense probably damaging 0.99
R0347:Rp1l1 UTSW 14 64030804 nonsense probably null
R0362:Rp1l1 UTSW 14 64031066 nonsense probably null
R0369:Rp1l1 UTSW 14 64029388 missense possibly damaging 0.84
R0538:Rp1l1 UTSW 14 64022092 missense probably damaging 1.00
R0544:Rp1l1 UTSW 14 64032066 missense probably benign 0.00
R0780:Rp1l1 UTSW 14 64030351 missense possibly damaging 0.94
R0944:Rp1l1 UTSW 14 64032232 missense probably benign 0.05
R1051:Rp1l1 UTSW 14 64032535 missense probably damaging 0.99
R1126:Rp1l1 UTSW 14 64030469 missense probably damaging 1.00
R1450:Rp1l1 UTSW 14 64028150 missense probably benign 0.01
R1483:Rp1l1 UTSW 14 64029047 missense possibly damaging 0.76
R1508:Rp1l1 UTSW 14 64030892 missense possibly damaging 0.83
R1553:Rp1l1 UTSW 14 64031894 missense probably benign 0.00
R1651:Rp1l1 UTSW 14 64030993 missense probably damaging 0.97
R1682:Rp1l1 UTSW 14 64028968 missense probably damaging 0.98
R1809:Rp1l1 UTSW 14 64027966 missense probably benign 0.18
R1885:Rp1l1 UTSW 14 64028390 missense probably benign 0.01
R1887:Rp1l1 UTSW 14 64028390 missense probably benign 0.01
R1898:Rp1l1 UTSW 14 64031590 missense probably benign 0.04
R1924:Rp1l1 UTSW 14 64031543 missense probably benign
R1939:Rp1l1 UTSW 14 64029593 missense probably benign
R1941:Rp1l1 UTSW 14 64022252 missense probably damaging 1.00
R2129:Rp1l1 UTSW 14 64028966 missense possibly damaging 0.93
R2363:Rp1l1 UTSW 14 64029998 missense possibly damaging 0.55
R3894:Rp1l1 UTSW 14 64029307 missense probably benign
R3974:Rp1l1 UTSW 14 64030309 missense probably damaging 1.00
R3975:Rp1l1 UTSW 14 64030309 missense probably damaging 1.00
R3976:Rp1l1 UTSW 14 64030309 missense probably damaging 1.00
R4072:Rp1l1 UTSW 14 64028132 missense probably damaging 1.00
R4672:Rp1l1 UTSW 14 64031270 missense probably damaging 1.00
R4673:Rp1l1 UTSW 14 64031270 missense probably damaging 1.00
R4749:Rp1l1 UTSW 14 64029800 missense probably damaging 0.99
R4755:Rp1l1 UTSW 14 64030070 missense probably benign 0.34
R4877:Rp1l1 UTSW 14 64026171 missense probably benign 0.00
R4930:Rp1l1 UTSW 14 64032206 missense probably benign
R5039:Rp1l1 UTSW 14 64031356 missense probably benign 0.21
R5106:Rp1l1 UTSW 14 64027946 missense probably damaging 1.00
R5184:Rp1l1 UTSW 14 64030180 missense probably damaging 1.00
R5215:Rp1l1 UTSW 14 64030013 missense probably benign 0.01
R5409:Rp1l1 UTSW 14 64030621 missense probably benign 0.02
R5575:Rp1l1 UTSW 14 64030984 missense probably benign 0.23
R5696:Rp1l1 UTSW 14 64029746 missense probably damaging 0.99
R5739:Rp1l1 UTSW 14 64032170 missense probably benign 0.01
R5878:Rp1l1 UTSW 14 64028906 missense probably benign 0.09
R6134:Rp1l1 UTSW 14 64030096 missense probably damaging 1.00
R6135:Rp1l1 UTSW 14 64030096 missense probably damaging 1.00
R6428:Rp1l1 UTSW 14 64032389 missense possibly damaging 0.92
R6594:Rp1l1 UTSW 14 64031677 nonsense probably null
R6736:Rp1l1 UTSW 14 64029724 missense possibly damaging 0.93
R6800:Rp1l1 UTSW 14 64031150 missense possibly damaging 0.92
R6848:Rp1l1 UTSW 14 64028218 missense possibly damaging 0.79
R6878:Rp1l1 UTSW 14 64031852 missense probably benign 0.00
R6922:Rp1l1 UTSW 14 64030385 missense possibly damaging 0.93
R6980:Rp1l1 UTSW 14 64028720 missense probably benign 0.02
R7053:Rp1l1 UTSW 14 64031509 missense possibly damaging 0.68
R7151:Rp1l1 UTSW 14 64029026 missense possibly damaging 0.73
R7291:Rp1l1 UTSW 14 64032298 missense probably benign 0.10
R7335:Rp1l1 UTSW 14 64031998 missense probably benign 0.00
R7344:Rp1l1 UTSW 14 64029620 missense probably benign 0.00
R7470:Rp1l1 UTSW 14 64028566 missense probably benign
R7570:Rp1l1 UTSW 14 64031574 nonsense probably null
R7585:Rp1l1 UTSW 14 64030139 missense probably damaging 0.96
R7591:Rp1l1 UTSW 14 64026109 missense probably damaging 1.00
R7667:Rp1l1 UTSW 14 64029803 missense probably benign 0.04
R7862:Rp1l1 UTSW 14 64028027 missense probably damaging 1.00
R7945:Rp1l1 UTSW 14 64028027 missense probably damaging 1.00
X0057:Rp1l1 UTSW 14 64030040 missense probably benign 0.14
X0063:Rp1l1 UTSW 14 64029223 missense probably damaging 0.98
Z1088:Rp1l1 UTSW 14 64028758 missense possibly damaging 0.80
Z1088:Rp1l1 UTSW 14 64030378 missense probably benign 0.01
Z1176:Rp1l1 UTSW 14 64029144 missense not run
Z1177:Rp1l1 UTSW 14 64032297 missense not run
Predicted Primers PCR Primer
(F):5'- AAGGGGCTACCAATGAGCAC -3'
(R):5'- AGAGTCTCAGCATCTCCTGG -3'

Sequencing Primer
(F):5'- GGCTACCAATGAGCACCCAGAG -3'
(R):5'- GTACTTAGGGGACTCTTCAAGCC -3'
Posted On2017-10-10