Incidental Mutation 'R6133:Lrrc15'
ID487251
Institutional Source Beutler Lab
Gene Symbol Lrrc15
Ensembl Gene ENSMUSG00000052316
Gene Nameleucine rich repeat containing 15
Synonyms5430427N11Rik
MMRRC Submission 044280-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6133 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location30269302-30283256 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 30274236 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 95 (G95D)
Ref Sequence ENSEMBL: ENSMUSP00000066777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064606]
Predicted Effect probably benign
Transcript: ENSMUST00000064606
AA Change: G95D

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000066777
Gene: ENSMUSG00000052316
AA Change: G95D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LRRNT 24 57 2.98e0 SMART
LRR 76 99 6.97e1 SMART
LRR_TYP 100 123 1.98e-4 SMART
LRR 124 147 4.08e0 SMART
LRR_TYP 148 171 2.4e-3 SMART
LRR_TYP 172 195 1.82e-3 SMART
LRR_TYP 196 219 1.18e-2 SMART
LRR_TYP 220 243 3.16e-3 SMART
LRR_TYP 245 267 3.39e-3 SMART
LRR_TYP 268 291 8.81e-2 SMART
LRR_TYP 292 315 9.5e-7 SMART
LRR_TYP 316 339 6.52e-5 SMART
LRR_TYP 340 363 7.78e-3 SMART
LRR_TYP 364 387 1.03e-2 SMART
LRR 388 411 8.48e0 SMART
LRRCT 423 474 1.11e-3 SMART
low complexity region 485 512 N/A INTRINSIC
transmembrane domain 537 559 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 A G 8: 88,325,439 T912A possibly damaging Het
Akap12 G T 10: 4,355,178 G663C probably benign Het
Akap2 C T 4: 57,855,516 Q525* probably null Het
Ankhd1 T C 18: 36,625,126 S958P possibly damaging Het
Cmtm2a T C 8: 104,292,730 I76V probably benign Het
Cpxm2 G A 7: 132,128,453 P146S probably damaging Het
Cubn A G 2: 13,308,618 V3047A probably benign Het
Dgkd T A 1: 87,938,240 V198E possibly damaging Het
Dnah3 A T 7: 120,086,246 M181K probably benign Het
Dnah7a T C 1: 53,419,655 T3775A probably benign Het
Dsg2 A G 18: 20,590,089 I391V probably benign Het
Ebi3 T A 17: 55,954,311 V69E probably benign Het
Fn1 T C 1: 71,597,727 T1998A probably damaging Het
Frmpd1 T A 4: 45,284,915 H1245Q probably benign Het
Gm7145 T A 1: 117,985,888 C167S probably damaging Het
Hydin C T 8: 110,601,276 T4805I probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnma1 C T 14: 24,003,868 M21I probably damaging Het
Lrfn5 A G 12: 61,843,788 D621G probably benign Het
Mex3d A G 10: 80,386,786 L212P probably damaging Het
Mmel1 C T 4: 154,895,018 H728Y probably damaging Het
Naip1 A G 13: 100,444,643 V32A probably benign Het
Nsl1 T C 1: 191,071,206 L158P probably damaging Het
Olfr638 A T 7: 104,003,325 T17S possibly damaging Het
Olfr771 G A 10: 129,160,883 L34F possibly damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Pcdh15 A T 10: 74,645,973 probably null Het
Pramef20 T C 4: 144,377,777 R53G possibly damaging Het
Ptpn1 T C 2: 167,967,796 V108A possibly damaging Het
Rad9b T C 5: 122,339,768 N182D possibly damaging Het
Rp1l1 C T 14: 64,030,096 P1044S probably damaging Het
Scn2a G A 2: 65,743,104 V1433I probably benign Het
Ssrp1 T G 2: 85,045,339 probably benign Het
Suco T A 1: 161,835,183 K560* probably null Het
Tbx3 T C 5: 119,680,953 V531A probably benign Het
Tmem30c T C 16: 57,277,737 Y107C probably damaging Het
Topbp1 T A 9: 103,311,764 probably null Het
Trpm5 A T 7: 143,088,951 D86E probably damaging Het
Urb2 C T 8: 124,028,561 Q336* probably null Het
Vmn2r43 A G 7: 8,244,971 F731S probably damaging Het
Xkr9 A G 1: 13,684,135 T118A probably benign Het
Zcchc2 A C 1: 106,019,879 K117N probably damaging Het
Zfp52 T C 17: 21,560,471 Y194H probably damaging Het
Zfp763 C T 17: 33,018,701 C490Y possibly damaging Het
Zmynd19 G T 2: 24,958,119 R148L possibly damaging Het
Other mutations in Lrrc15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Lrrc15 APN 16 30274030 missense possibly damaging 0.90
IGL01720:Lrrc15 APN 16 30273320 missense probably benign 0.19
R0138:Lrrc15 UTSW 16 30273449 missense possibly damaging 0.63
R0317:Lrrc15 UTSW 16 30273743 missense probably benign
R0497:Lrrc15 UTSW 16 30272892 missense probably damaging 0.98
R0528:Lrrc15 UTSW 16 30273748 missense probably damaging 0.99
R1122:Lrrc15 UTSW 16 30273901 missense probably damaging 1.00
R1950:Lrrc15 UTSW 16 30273831 missense probably benign 0.21
R2898:Lrrc15 UTSW 16 30273786 missense probably benign 0.01
R4272:Lrrc15 UTSW 16 30273855 missense probably benign 0.06
R4839:Lrrc15 UTSW 16 30274268 missense probably benign 0.00
R5091:Lrrc15 UTSW 16 30273354 missense probably damaging 1.00
R5369:Lrrc15 UTSW 16 30272904 missense possibly damaging 0.93
R6076:Lrrc15 UTSW 16 30272988 missense probably benign 0.25
R7017:Lrrc15 UTSW 16 30272962 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGCCATACAACTGGAGTTCCTTAAG -3'
(R):5'- CCCAGCGAATGTACCTGTTC -3'

Sequencing Primer
(F):5'- CCTTAAGATTACTAAACTGGGAGAAC -3'
(R):5'- AATGTACCTGTTCCCGGGC -3'
Posted On2017-10-10