Incidental Mutation 'R6133:Tmem30c'
ID487252
Institutional Source Beutler Lab
Gene Symbol Tmem30c
Ensembl Gene ENSMUSG00000022753
Gene Nametransmembrane protein 30C
Synonyms4933409A18Rik, 4933401B01Rik
MMRRC Submission 044280-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R6133 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location57266139-57292865 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57277737 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 107 (Y107C)
Ref Sequence ENSEMBL: ENSMUSP00000113896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023434] [ENSMUST00000119407] [ENSMUST00000120112]
Predicted Effect probably damaging
Transcript: ENSMUST00000023434
AA Change: Y107C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023434
Gene: ENSMUSG00000022753
AA Change: Y107C

DomainStartEndE-ValueType
Pfam:CDC50 54 339 2.7e-84 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119407
AA Change: Y107C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112989
Gene: ENSMUSG00000022753
AA Change: Y107C

DomainStartEndE-ValueType
Pfam:CDC50 53 340 2.6e-89 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120112
AA Change: Y107C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113896
Gene: ENSMUSG00000022753
AA Change: Y107C

DomainStartEndE-ValueType
Pfam:CDC50 53 283 9.9e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180871
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 A G 8: 88,325,439 T912A possibly damaging Het
Akap12 G T 10: 4,355,178 G663C probably benign Het
Akap2 C T 4: 57,855,516 Q525* probably null Het
Ankhd1 T C 18: 36,625,126 S958P possibly damaging Het
Cmtm2a T C 8: 104,292,730 I76V probably benign Het
Cpxm2 G A 7: 132,128,453 P146S probably damaging Het
Cubn A G 2: 13,308,618 V3047A probably benign Het
Dgkd T A 1: 87,938,240 V198E possibly damaging Het
Dnah3 A T 7: 120,086,246 M181K probably benign Het
Dnah7a T C 1: 53,419,655 T3775A probably benign Het
Dsg2 A G 18: 20,590,089 I391V probably benign Het
Ebi3 T A 17: 55,954,311 V69E probably benign Het
Fn1 T C 1: 71,597,727 T1998A probably damaging Het
Frmpd1 T A 4: 45,284,915 H1245Q probably benign Het
Gm7145 T A 1: 117,985,888 C167S probably damaging Het
Hydin C T 8: 110,601,276 T4805I probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnma1 C T 14: 24,003,868 M21I probably damaging Het
Lrfn5 A G 12: 61,843,788 D621G probably benign Het
Lrrc15 C T 16: 30,274,236 G95D probably benign Het
Mex3d A G 10: 80,386,786 L212P probably damaging Het
Mmel1 C T 4: 154,895,018 H728Y probably damaging Het
Naip1 A G 13: 100,444,643 V32A probably benign Het
Nsl1 T C 1: 191,071,206 L158P probably damaging Het
Olfr638 A T 7: 104,003,325 T17S possibly damaging Het
Olfr771 G A 10: 129,160,883 L34F possibly damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Pcdh15 A T 10: 74,645,973 probably null Het
Pramef20 T C 4: 144,377,777 R53G possibly damaging Het
Ptpn1 T C 2: 167,967,796 V108A possibly damaging Het
Rad9b T C 5: 122,339,768 N182D possibly damaging Het
Rp1l1 C T 14: 64,030,096 P1044S probably damaging Het
Scn2a G A 2: 65,743,104 V1433I probably benign Het
Ssrp1 T G 2: 85,045,339 probably benign Het
Suco T A 1: 161,835,183 K560* probably null Het
Tbx3 T C 5: 119,680,953 V531A probably benign Het
Topbp1 T A 9: 103,311,764 probably null Het
Trpm5 A T 7: 143,088,951 D86E probably damaging Het
Urb2 C T 8: 124,028,561 Q336* probably null Het
Vmn2r43 A G 7: 8,244,971 F731S probably damaging Het
Xkr9 A G 1: 13,684,135 T118A probably benign Het
Zcchc2 A C 1: 106,019,879 K117N probably damaging Het
Zfp52 T C 17: 21,560,471 Y194H probably damaging Het
Zfp763 C T 17: 33,018,701 C490Y possibly damaging Het
Zmynd19 G T 2: 24,958,119 R148L possibly damaging Het
Other mutations in Tmem30c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Tmem30c APN 16 57270074 missense probably damaging 1.00
IGL01115:Tmem30c APN 16 57276117 splice site probably benign
IGL01574:Tmem30c APN 16 57276742 missense possibly damaging 0.60
IGL02060:Tmem30c APN 16 57290898 missense probably benign
IGL03243:Tmem30c APN 16 57276150 missense probably benign 0.00
R0689:Tmem30c UTSW 16 57270173 missense probably damaging 1.00
R0699:Tmem30c UTSW 16 57276789 missense possibly damaging 0.69
R0763:Tmem30c UTSW 16 57270176 missense possibly damaging 0.90
R1353:Tmem30c UTSW 16 57277665 missense probably damaging 1.00
R1518:Tmem30c UTSW 16 57266492 missense probably damaging 0.99
R1707:Tmem30c UTSW 16 57266480 missense possibly damaging 0.79
R1843:Tmem30c UTSW 16 57276780 missense probably benign 0.02
R1865:Tmem30c UTSW 16 57269989 splice site probably benign
R2021:Tmem30c UTSW 16 57281362 missense probably damaging 1.00
R3419:Tmem30c UTSW 16 57277668 missense probably benign 0.25
R5007:Tmem30c UTSW 16 57266505 missense probably benign 0.00
R5204:Tmem30c UTSW 16 57270022 missense possibly damaging 0.89
R5626:Tmem30c UTSW 16 57276143 missense possibly damaging 0.74
R5863:Tmem30c UTSW 16 57270055 missense probably benign 0.02
R5869:Tmem30c UTSW 16 57266562 missense probably damaging 0.99
R6359:Tmem30c UTSW 16 57276150 missense probably benign 0.00
R6813:Tmem30c UTSW 16 57281259 critical splice donor site probably null
R7268:Tmem30c UTSW 16 57266414 missense probably damaging 0.98
R7387:Tmem30c UTSW 16 57270023 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ACTTAGATGCTGAGGCCCAC -3'
(R):5'- TGAATGTATTGAAACCACACAGCC -3'

Sequencing Primer
(F):5'- ACCCCATGCCTGTCTTTTAGATGG -3'
(R):5'- GCTACTCAGAGAGATGCTGTC -3'
Posted On2017-10-10