Incidental Mutation 'R6134:Miga2'
ID487261
Institutional Source Beutler Lab
Gene Symbol Miga2
Ensembl Gene ENSMUSG00000026858
Gene Namemitoguardin 2
SynonymsFam73b, R74766, 5730472N09Rik
MMRRC Submission 044281-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6134 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location30364233-30385521 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30371217 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 175 (S175G)
Ref Sequence ENSEMBL: ENSMUSP00000135519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077977] [ENSMUST00000100214] [ENSMUST00000116543] [ENSMUST00000140075] [ENSMUST00000142801]
Predicted Effect probably benign
Transcript: ENSMUST00000077977
AA Change: S175G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000077127
Gene: ENSMUSG00000026858
AA Change: S175G

DomainStartEndE-ValueType
Pfam:DUF2217 30 568 5.6e-242 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100214
AA Change: S175G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000097787
Gene: ENSMUSG00000026858
AA Change: S175G

DomainStartEndE-ValueType
Pfam:DUF2217 31 568 6.9e-228 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116543
SMART Domains Protein: ENSMUSP00000135126
Gene: ENSMUSG00000026858

DomainStartEndE-ValueType
Pfam:DUF2217 1 91 3.6e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135841
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137441
Predicted Effect probably benign
Transcript: ENSMUST00000140075
AA Change: S175G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000135519
Gene: ENSMUSG00000026858
AA Change: S175G

DomainStartEndE-ValueType
Pfam:DUF2217 30 393 5.1e-125 PFAM
low complexity region 409 420 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142801
SMART Domains Protein: ENSMUSP00000118253
Gene: ENSMUSG00000026858

DomainStartEndE-ValueType
Pfam:DUF2217 30 139 4.1e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198501
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 94% (51/54)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik G A 11: 58,876,793 E39K probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Aktip T A 8: 91,129,760 S30C probably damaging Het
Anxa10 G T 8: 62,077,943 H78N probably damaging Het
Aoah C T 13: 20,911,123 R196W probably damaging Het
Arl4c A T 1: 88,701,430 W79R probably damaging Het
Brd2 A T 17: 34,113,695 D178E probably benign Het
Cacna1e G A 1: 154,701,291 P120L probably damaging Het
Cdh16 A T 8: 104,616,065 M17K probably benign Het
Chit1 A G 1: 134,144,060 T103A possibly damaging Het
Clcn3 T C 8: 60,934,573 Y214C probably damaging Het
Coch T A 12: 51,602,753 D282E probably damaging Het
Col1a2 C A 6: 4,538,035 S1181R unknown Het
Col6a2 T C 10: 76,607,144 D506G probably damaging Het
Crx A T 7: 15,868,107 Y215* probably null Het
Fam160a1 T C 3: 85,673,344 E518G possibly damaging Het
Fasn A T 11: 120,822,186 S58T probably benign Het
Garem1 A T 18: 21,129,824 D644E probably benign Het
Gm4763 G A 7: 24,726,056 A3V probably damaging Het
H2-Q2 A C 17: 35,343,241 T155P probably damaging Het
Insr A T 8: 3,192,572 I49N probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Lnpep A G 17: 17,553,192 M639T probably benign Het
Map3k20 C T 2: 72,410,159 S333F probably damaging Het
Muc3a A T 5: 137,210,122 I191N probably damaging Het
Ncoa2 A G 1: 13,174,371 V701A probably damaging Het
Nid2 T C 14: 19,778,783 V565A probably damaging Het
Nova2 G A 7: 18,957,869 A244T unknown Het
Numbl G C 7: 27,281,314 A574P probably damaging Het
Oas3 A G 5: 120,769,048 V508A unknown Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Pcdhb21 T A 18: 37,514,408 S197T probably benign Het
Pck2 T A 14: 55,543,962 M180K probably damaging Het
Pgr T C 9: 8,900,739 V91A possibly damaging Het
Phtf1 A T 3: 104,004,405 M643L probably damaging Het
Prokr1 T C 6: 87,588,855 T3A possibly damaging Het
Ptgs1 T C 2: 36,251,178 Y546H probably damaging Het
Rasa1 A G 13: 85,226,626 L742P probably benign Het
Rbbp6 T C 7: 122,997,311 probably null Het
Rgs22 A G 15: 36,107,048 L64P probably damaging Het
Rnf213 A T 11: 119,411,470 I407F probably damaging Het
Rp1l1 C T 14: 64,030,096 P1044S probably damaging Het
RP24-388A6.3 A T 5: 16,824,685 D473V probably damaging Het
Scin G A 12: 40,060,579 P690L probably damaging Het
Sept9 T C 11: 117,352,161 L58P probably damaging Het
Slc1a7 A G 4: 108,012,436 E566G probably damaging Het
Speer4f1 G A 5: 17,476,142 R6Q probably benign Het
Tnxb A T 17: 34,672,012 Y443F probably damaging Het
Trpv1 A G 11: 73,244,317 I79V probably benign Het
Ttll6 C T 11: 96,139,742 T245I possibly damaging Het
Vmn2r26 T C 6: 124,061,485 I673T probably damaging Het
Zfp60 T C 7: 27,749,898 F664L probably benign Het
Other mutations in Miga2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Miga2 APN 2 30367717 missense probably benign 0.04
IGL01353:Miga2 APN 2 30371233 critical splice donor site probably null
IGL01679:Miga2 APN 2 30378250 missense probably benign 0.07
IGL03113:Miga2 APN 2 30384010 missense possibly damaging 0.96
uncertain UTSW 2 30371196 missense probably benign 0.00
R0620:Miga2 UTSW 2 30381744 unclassified probably benign
R1698:Miga2 UTSW 2 30377997 missense probably damaging 1.00
R1729:Miga2 UTSW 2 30368968 missense probably damaging 1.00
R1994:Miga2 UTSW 2 30381988 missense probably damaging 1.00
R2377:Miga2 UTSW 2 30383990 nonsense probably null
R2891:Miga2 UTSW 2 30378294 splice site probably null
R2892:Miga2 UTSW 2 30378294 splice site probably null
R2893:Miga2 UTSW 2 30378294 splice site probably null
R3788:Miga2 UTSW 2 30371225 nonsense probably null
R4042:Miga2 UTSW 2 30367726 missense possibly damaging 0.87
R5214:Miga2 UTSW 2 30371196 missense probably benign 0.00
R5750:Miga2 UTSW 2 30371565 missense probably damaging 1.00
R5928:Miga2 UTSW 2 30368863 splice site probably benign
R6209:Miga2 UTSW 2 30381662 missense probably damaging 1.00
R6860:Miga2 UTSW 2 30371163 missense probably benign 0.15
R7373:Miga2 UTSW 2 30382071 missense probably damaging 1.00
R7884:Miga2 UTSW 2 30371204 missense probably benign 0.02
R8370:Miga2 UTSW 2 30375743 frame shift probably null
R8371:Miga2 UTSW 2 30375743 frame shift probably null
R8374:Miga2 UTSW 2 30375743 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GTATCTAGGAGAGTACCTGTGGC -3'
(R):5'- GACTCTACAGCTGGGTCTTG -3'

Sequencing Primer
(F):5'- AGAGTACCTGTGGCCTGCG -3'
(R):5'- TGGGCTATCCAGTACTTAGGC -3'
Posted On2017-10-10