Incidental Mutation 'R6134:Phtf1'
ID487265
Institutional Source Beutler Lab
Gene Symbol Phtf1
Ensembl Gene ENSMUSG00000058388
Gene Nameputative homeodomain transcription factor 1
SynonymsPhft
MMRRC Submission 044281-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6134 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location103968110-104024598 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104004405 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 643 (M643L)
Ref Sequence ENSEMBL: ENSMUSP00000088184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055425] [ENSMUST00000063717] [ENSMUST00000090685] [ENSMUST00000117150] [ENSMUST00000145727]
Predicted Effect probably damaging
Transcript: ENSMUST00000055425
AA Change: M635L

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000058137
Gene: ENSMUSG00000058388
AA Change: M635L

DomainStartEndE-ValueType
Pfam:Phtf-FEM1B_bdg 3 60 8.6e-31 PFAM
Pfam:Phtf-FEM1B_bdg 57 105 5.2e-18 PFAM
low complexity region 117 128 N/A INTRINSIC
low complexity region 294 317 N/A INTRINSIC
transmembrane domain 470 492 N/A INTRINSIC
transmembrane domain 557 579 N/A INTRINSIC
transmembrane domain 594 611 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000063717
AA Change: M688L

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000066607
Gene: ENSMUSG00000058388
AA Change: M688L

DomainStartEndE-ValueType
Pfam:Phtf-FEM1B_bdg 5 151 9.9e-73 PFAM
low complexity region 155 163 N/A INTRINSIC
low complexity region 170 181 N/A INTRINSIC
low complexity region 347 370 N/A INTRINSIC
transmembrane domain 473 492 N/A INTRINSIC
transmembrane domain 512 534 N/A INTRINSIC
transmembrane domain 610 632 N/A INTRINSIC
transmembrane domain 647 664 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000090685
AA Change: M643L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000088184
Gene: ENSMUSG00000058388
AA Change: M643L

DomainStartEndE-ValueType
Pfam:Phtf-FEM1B_bdg 3 158 8.9e-89 PFAM
low complexity region 302 325 N/A INTRINSIC
transmembrane domain 428 447 N/A INTRINSIC
transmembrane domain 467 489 N/A INTRINSIC
transmembrane domain 565 587 N/A INTRINSIC
transmembrane domain 602 619 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117150
AA Change: M688L

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113973
Gene: ENSMUSG00000058388
AA Change: M688L

DomainStartEndE-ValueType
Pfam:Phtf-FEM1B_bdg 3 158 1.6e-88 PFAM
low complexity region 170 181 N/A INTRINSIC
low complexity region 347 370 N/A INTRINSIC
transmembrane domain 473 492 N/A INTRINSIC
transmembrane domain 512 534 N/A INTRINSIC
transmembrane domain 610 632 N/A INTRINSIC
transmembrane domain 647 664 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000145727
AA Change: M688L

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114722
Gene: ENSMUSG00000058388
AA Change: M688L

DomainStartEndE-ValueType
Pfam:Phtf-FEM1B_bdg 3 158 1.6e-88 PFAM
low complexity region 170 181 N/A INTRINSIC
low complexity region 347 370 N/A INTRINSIC
transmembrane domain 473 492 N/A INTRINSIC
transmembrane domain 512 534 N/A INTRINSIC
transmembrane domain 610 632 N/A INTRINSIC
transmembrane domain 647 664 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150090
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 94% (51/54)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik G A 11: 58,876,793 E39K probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Aktip T A 8: 91,129,760 S30C probably damaging Het
Anxa10 G T 8: 62,077,943 H78N probably damaging Het
Aoah C T 13: 20,911,123 R196W probably damaging Het
Arl4c A T 1: 88,701,430 W79R probably damaging Het
Brd2 A T 17: 34,113,695 D178E probably benign Het
Cacna1e G A 1: 154,701,291 P120L probably damaging Het
Cdh16 A T 8: 104,616,065 M17K probably benign Het
Chit1 A G 1: 134,144,060 T103A possibly damaging Het
Clcn3 T C 8: 60,934,573 Y214C probably damaging Het
Coch T A 12: 51,602,753 D282E probably damaging Het
Col1a2 C A 6: 4,538,035 S1181R unknown Het
Col6a2 T C 10: 76,607,144 D506G probably damaging Het
Crx A T 7: 15,868,107 Y215* probably null Het
Fam160a1 T C 3: 85,673,344 E518G possibly damaging Het
Fasn A T 11: 120,822,186 S58T probably benign Het
Garem1 A T 18: 21,129,824 D644E probably benign Het
Gm4763 G A 7: 24,726,056 A3V probably damaging Het
H2-Q2 A C 17: 35,343,241 T155P probably damaging Het
Insr A T 8: 3,192,572 I49N probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Lnpep A G 17: 17,553,192 M639T probably benign Het
Map3k20 C T 2: 72,410,159 S333F probably damaging Het
Miga2 A G 2: 30,371,217 S175G probably benign Het
Muc3a A T 5: 137,210,122 I191N probably damaging Het
Ncoa2 A G 1: 13,174,371 V701A probably damaging Het
Nid2 T C 14: 19,778,783 V565A probably damaging Het
Nova2 G A 7: 18,957,869 A244T unknown Het
Numbl G C 7: 27,281,314 A574P probably damaging Het
Oas3 A G 5: 120,769,048 V508A unknown Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Pcdhb21 T A 18: 37,514,408 S197T probably benign Het
Pck2 T A 14: 55,543,962 M180K probably damaging Het
Pgr T C 9: 8,900,739 V91A possibly damaging Het
Prokr1 T C 6: 87,588,855 T3A possibly damaging Het
Ptgs1 T C 2: 36,251,178 Y546H probably damaging Het
Rasa1 A G 13: 85,226,626 L742P probably benign Het
Rbbp6 T C 7: 122,997,311 probably null Het
Rgs22 A G 15: 36,107,048 L64P probably damaging Het
Rnf213 A T 11: 119,411,470 I407F probably damaging Het
Rp1l1 C T 14: 64,030,096 P1044S probably damaging Het
RP24-388A6.3 A T 5: 16,824,685 D473V probably damaging Het
Scin G A 12: 40,060,579 P690L probably damaging Het
Sept9 T C 11: 117,352,161 L58P probably damaging Het
Slc1a7 A G 4: 108,012,436 E566G probably damaging Het
Speer4f1 G A 5: 17,476,142 R6Q probably benign Het
Tnxb A T 17: 34,672,012 Y443F probably damaging Het
Trpv1 A G 11: 73,244,317 I79V probably benign Het
Ttll6 C T 11: 96,139,742 T245I possibly damaging Het
Vmn2r26 T C 6: 124,061,485 I673T probably damaging Het
Zfp60 T C 7: 27,749,898 F664L probably benign Het
Other mutations in Phtf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Phtf1 APN 3 103988667 missense probably benign
IGL01139:Phtf1 APN 3 104005602 missense probably damaging 1.00
IGL01677:Phtf1 APN 3 103998783 missense probably damaging 1.00
IGL02169:Phtf1 APN 3 103997499 missense probably benign
IGL02542:Phtf1 APN 3 103993906 splice site probably benign
IGL02557:Phtf1 APN 3 103998765 missense probably damaging 1.00
IGL02697:Phtf1 APN 3 103997563 missense probably benign
IGL02807:Phtf1 APN 3 103997553 missense probably benign 0.00
R0140:Phtf1 UTSW 3 103987560 missense probably null 1.00
R0555:Phtf1 UTSW 3 104004469 missense probably damaging 1.00
R0620:Phtf1 UTSW 3 103993765 missense probably damaging 1.00
R1480:Phtf1 UTSW 3 103987434 nonsense probably null
R1799:Phtf1 UTSW 3 103996642 missense probably benign 0.01
R1804:Phtf1 UTSW 3 103987567 unclassified probably benign
R1921:Phtf1 UTSW 3 103969122 nonsense probably null
R1943:Phtf1 UTSW 3 103993882 nonsense probably null
R2006:Phtf1 UTSW 3 104004483 critical splice donor site probably null
R3729:Phtf1 UTSW 3 103985779 missense probably benign 0.00
R3731:Phtf1 UTSW 3 103985779 missense probably benign 0.00
R4051:Phtf1 UTSW 3 104005508 missense possibly damaging 0.92
R4210:Phtf1 UTSW 3 104003603 critical splice donor site probably null
R4211:Phtf1 UTSW 3 104003603 critical splice donor site probably null
R4730:Phtf1 UTSW 3 103987435 missense probably damaging 1.00
R4982:Phtf1 UTSW 3 103998708 missense probably damaging 1.00
R5314:Phtf1 UTSW 3 103999287 missense probably damaging 1.00
R5321:Phtf1 UTSW 3 104003511 missense probably benign 0.31
R5499:Phtf1 UTSW 3 103991175 missense probably benign 0.00
R6603:Phtf1 UTSW 3 103993873 missense probably damaging 1.00
R7242:Phtf1 UTSW 3 103998696 missense probably damaging 0.99
R7311:Phtf1 UTSW 3 103997664 missense possibly damaging 0.64
R7519:Phtf1 UTSW 3 103969119 missense probably damaging 1.00
R7601:Phtf1 UTSW 3 103993845 missense probably benign 0.03
R7657:Phtf1 UTSW 3 103969113 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTAGCTTTTCTTTACCACAGAGG -3'
(R):5'- TGGAAGCCACTCTCCCTAAG -3'

Sequencing Primer
(F):5'- CCACAGAGGTAAACGATGGG -3'
(R):5'- AGTTCCTTCTAGAAGCTTCTGACAG -3'
Posted On2017-10-10