Incidental Mutation 'R6134:Oas3'
ID487269
Institutional Source Beutler Lab
Gene Symbol Oas3
Ensembl Gene ENSMUSG00000032661
Gene Name2'-5' oligoadenylate synthetase 3
SynonymsOasl10, 2'-5' oligoadenylate synthetase-like 10
MMRRC Submission 044281-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R6134 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location120753098-120777661 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120769048 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 508 (V508A)
Ref Sequence ENSEMBL: ENSMUSP00000035588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044833]
Predicted Effect unknown
Transcript: ENSMUST00000044833
AA Change: V508A
SMART Domains Protein: ENSMUSP00000035588
Gene: ENSMUSG00000032661
AA Change: V508A

DomainStartEndE-ValueType
Pfam:OAS1_C 159 341 6.3e-83 PFAM
Pfam:OAS1_C 610 795 3.1e-78 PFAM
Pfam:NTP_transf_2 831 920 4.5e-11 PFAM
Pfam:OAS1_C 954 1136 9e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166703
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 94% (51/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme included in the 2', 5' oligoadenylate synthase family. This enzyme is induced by interferons and catalyzes the 2', 5' oligomers of adenosine in order to bind and activate RNase L. This enzyme family plays a significant role in the inhibition of cellular protein synthesis and viral infection resistance. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik G A 11: 58,876,793 E39K probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Aktip T A 8: 91,129,760 S30C probably damaging Het
Anxa10 G T 8: 62,077,943 H78N probably damaging Het
Aoah C T 13: 20,911,123 R196W probably damaging Het
Arl4c A T 1: 88,701,430 W79R probably damaging Het
Brd2 A T 17: 34,113,695 D178E probably benign Het
Cacna1e G A 1: 154,701,291 P120L probably damaging Het
Cdh16 A T 8: 104,616,065 M17K probably benign Het
Chit1 A G 1: 134,144,060 T103A possibly damaging Het
Clcn3 T C 8: 60,934,573 Y214C probably damaging Het
Coch T A 12: 51,602,753 D282E probably damaging Het
Col1a2 C A 6: 4,538,035 S1181R unknown Het
Col6a2 T C 10: 76,607,144 D506G probably damaging Het
Crx A T 7: 15,868,107 Y215* probably null Het
Fam160a1 T C 3: 85,673,344 E518G possibly damaging Het
Fasn A T 11: 120,822,186 S58T probably benign Het
Garem1 A T 18: 21,129,824 D644E probably benign Het
Gm4763 G A 7: 24,726,056 A3V probably damaging Het
H2-Q2 A C 17: 35,343,241 T155P probably damaging Het
Insr A T 8: 3,192,572 I49N probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Lnpep A G 17: 17,553,192 M639T probably benign Het
Map3k20 C T 2: 72,410,159 S333F probably damaging Het
Miga2 A G 2: 30,371,217 S175G probably benign Het
Muc3a A T 5: 137,210,122 I191N probably damaging Het
Ncoa2 A G 1: 13,174,371 V701A probably damaging Het
Nid2 T C 14: 19,778,783 V565A probably damaging Het
Nova2 G A 7: 18,957,869 A244T unknown Het
Numbl G C 7: 27,281,314 A574P probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Pcdhb21 T A 18: 37,514,408 S197T probably benign Het
Pck2 T A 14: 55,543,962 M180K probably damaging Het
Pgr T C 9: 8,900,739 V91A possibly damaging Het
Phtf1 A T 3: 104,004,405 M643L probably damaging Het
Prokr1 T C 6: 87,588,855 T3A possibly damaging Het
Ptgs1 T C 2: 36,251,178 Y546H probably damaging Het
Rasa1 A G 13: 85,226,626 L742P probably benign Het
Rbbp6 T C 7: 122,997,311 probably null Het
Rgs22 A G 15: 36,107,048 L64P probably damaging Het
Rnf213 A T 11: 119,411,470 I407F probably damaging Het
Rp1l1 C T 14: 64,030,096 P1044S probably damaging Het
RP24-388A6.3 A T 5: 16,824,685 D473V probably damaging Het
Scin G A 12: 40,060,579 P690L probably damaging Het
Sept9 T C 11: 117,352,161 L58P probably damaging Het
Slc1a7 A G 4: 108,012,436 E566G probably damaging Het
Speer4f1 G A 5: 17,476,142 R6Q probably benign Het
Tnxb A T 17: 34,672,012 Y443F probably damaging Het
Trpv1 A G 11: 73,244,317 I79V probably benign Het
Ttll6 C T 11: 96,139,742 T245I possibly damaging Het
Vmn2r26 T C 6: 124,061,485 I673T probably damaging Het
Zfp60 T C 7: 27,749,898 F664L probably benign Het
Other mutations in Oas3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Oas3 APN 5 120777442 splice site probably benign
IGL01095:Oas3 APN 5 120772889 missense probably damaging 1.00
IGL01835:Oas3 APN 5 120766128 nonsense probably null
IGL02006:Oas3 APN 5 120769235 missense probably benign 0.00
IGL02811:Oas3 APN 5 120764322 missense unknown
IGL03194:Oas3 APN 5 120758953 missense probably damaging 1.00
R0066:Oas3 UTSW 5 120758875 missense probably damaging 1.00
R0195:Oas3 UTSW 5 120756145 missense probably damaging 1.00
R0196:Oas3 UTSW 5 120756145 missense probably damaging 1.00
R0197:Oas3 UTSW 5 120756145 missense probably damaging 1.00
R0445:Oas3 UTSW 5 120756145 missense probably damaging 1.00
R0523:Oas3 UTSW 5 120766144 missense unknown
R0592:Oas3 UTSW 5 120771149 missense probably damaging 1.00
R0946:Oas3 UTSW 5 120769063 missense unknown
R1354:Oas3 UTSW 5 120770000 missense possibly damaging 0.94
R1642:Oas3 UTSW 5 120777574 missense possibly damaging 0.90
R1681:Oas3 UTSW 5 120769908 missense probably benign 0.22
R1844:Oas3 UTSW 5 120759980 missense probably damaging 0.99
R1981:Oas3 UTSW 5 120761835 splice site probably benign
R2443:Oas3 UTSW 5 120777488 missense probably benign 0.35
R2902:Oas3 UTSW 5 120758917 missense probably damaging 1.00
R3034:Oas3 UTSW 5 120771056 missense probably damaging 1.00
R4565:Oas3 UTSW 5 120771039 missense probably damaging 1.00
R4692:Oas3 UTSW 5 120769355 missense probably benign 0.03
R4723:Oas3 UTSW 5 120766256 missense unknown
R4812:Oas3 UTSW 5 120761147 unclassified probably benign
R5288:Oas3 UTSW 5 120756990 missense probably damaging 1.00
R5343:Oas3 UTSW 5 120756238 missense possibly damaging 0.70
R5494:Oas3 UTSW 5 120761644 missense unknown
R5688:Oas3 UTSW 5 120758802 missense probably benign 0.31
R5894:Oas3 UTSW 5 120756954 missense probably damaging 1.00
R5921:Oas3 UTSW 5 120769981 missense probably damaging 1.00
R6037:Oas3 UTSW 5 120769319 missense probably benign 0.41
R6037:Oas3 UTSW 5 120769319 missense probably benign 0.41
R6066:Oas3 UTSW 5 120772924 missense probably damaging 0.97
R6104:Oas3 UTSW 5 120761693 missense unknown
R6255:Oas3 UTSW 5 120771230 missense probably benign 0.04
R6257:Oas3 UTSW 5 120761135 unclassified probably benign
R6776:Oas3 UTSW 5 120758874 missense probably damaging 1.00
R8022:Oas3 UTSW 5 120756966 missense possibly damaging 0.91
RF006:Oas3 UTSW 5 120774100 missense probably damaging 1.00
X0024:Oas3 UTSW 5 120761728 missense unknown
Predicted Primers PCR Primer
(F):5'- CTCCATTGTAACCCAAGGAGTGTC -3'
(R):5'- ATGTTCGGATCACCCAGAGC -3'

Sequencing Primer
(F):5'- AACCCAAGGAGTGTCTGTTTGTC -3'
(R):5'- TAGCATCTCCACCGCTGG -3'
Posted On2017-10-10