Incidental Mutation 'R6134:Muc3a'
ID487270
Institutional Source Beutler Lab
Gene Symbol Muc3a
Ensembl Gene ENSMUSG00000094840
Gene Namemucin 3A, cell surface associated
SynonymsA630081J09Rik
MMRRC Submission 044281-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6134 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location137208813-137212389 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 137210122 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 191 (I191N)
Ref Sequence ENSEMBL: ENSMUSP00000136061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179412]
Predicted Effect probably damaging
Transcript: ENSMUST00000179412
AA Change: I191N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136061
Gene: ENSMUSG00000094840
AA Change: I191N

DomainStartEndE-ValueType
Blast:EGF_like 54 95 1e-22 BLAST
transmembrane domain 103 125 N/A INTRINSIC
low complexity region 198 218 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000196391
AA Change: I189N
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 94% (51/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The mucin genes encode epithelial glycoproteins, some of which are secreted and some membrane bound. Each of the genes contains at least one large domain of tandemly repeated sequence that encodes the peptide sequence rich in serine and/or threonine residues, which carries most of the O-linked glycosylation (Gendler and Spicer, 1995 [PubMed 7778880]).[supplied by OMIM, Aug 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik G A 11: 58,876,793 E39K probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Aktip T A 8: 91,129,760 S30C probably damaging Het
Anxa10 G T 8: 62,077,943 H78N probably damaging Het
Aoah C T 13: 20,911,123 R196W probably damaging Het
Arl4c A T 1: 88,701,430 W79R probably damaging Het
Brd2 A T 17: 34,113,695 D178E probably benign Het
Cacna1e G A 1: 154,701,291 P120L probably damaging Het
Cdh16 A T 8: 104,616,065 M17K probably benign Het
Chit1 A G 1: 134,144,060 T103A possibly damaging Het
Clcn3 T C 8: 60,934,573 Y214C probably damaging Het
Coch T A 12: 51,602,753 D282E probably damaging Het
Col1a2 C A 6: 4,538,035 S1181R unknown Het
Col6a2 T C 10: 76,607,144 D506G probably damaging Het
Crx A T 7: 15,868,107 Y215* probably null Het
Fam160a1 T C 3: 85,673,344 E518G possibly damaging Het
Fasn A T 11: 120,822,186 S58T probably benign Het
Garem1 A T 18: 21,129,824 D644E probably benign Het
Gm4763 G A 7: 24,726,056 A3V probably damaging Het
H2-Q2 A C 17: 35,343,241 T155P probably damaging Het
Insr A T 8: 3,192,572 I49N probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Lnpep A G 17: 17,553,192 M639T probably benign Het
Map3k20 C T 2: 72,410,159 S333F probably damaging Het
Miga2 A G 2: 30,371,217 S175G probably benign Het
Ncoa2 A G 1: 13,174,371 V701A probably damaging Het
Nid2 T C 14: 19,778,783 V565A probably damaging Het
Nova2 G A 7: 18,957,869 A244T unknown Het
Numbl G C 7: 27,281,314 A574P probably damaging Het
Oas3 A G 5: 120,769,048 V508A unknown Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Pcdhb21 T A 18: 37,514,408 S197T probably benign Het
Pck2 T A 14: 55,543,962 M180K probably damaging Het
Pgr T C 9: 8,900,739 V91A possibly damaging Het
Phtf1 A T 3: 104,004,405 M643L probably damaging Het
Prokr1 T C 6: 87,588,855 T3A possibly damaging Het
Ptgs1 T C 2: 36,251,178 Y546H probably damaging Het
Rasa1 A G 13: 85,226,626 L742P probably benign Het
Rbbp6 T C 7: 122,997,311 probably null Het
Rgs22 A G 15: 36,107,048 L64P probably damaging Het
Rnf213 A T 11: 119,411,470 I407F probably damaging Het
Rp1l1 C T 14: 64,030,096 P1044S probably damaging Het
RP24-388A6.3 A T 5: 16,824,685 D473V probably damaging Het
Scin G A 12: 40,060,579 P690L probably damaging Het
Sept9 T C 11: 117,352,161 L58P probably damaging Het
Slc1a7 A G 4: 108,012,436 E566G probably damaging Het
Speer4f1 G A 5: 17,476,142 R6Q probably benign Het
Tnxb A T 17: 34,672,012 Y443F probably damaging Het
Trpv1 A G 11: 73,244,317 I79V probably benign Het
Ttll6 C T 11: 96,139,742 T245I possibly damaging Het
Vmn2r26 T C 6: 124,061,485 I673T probably damaging Het
Zfp60 T C 7: 27,749,898 F664L probably benign Het
Other mutations in Muc3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1500:Muc3a UTSW 5 137210501 splice site probably benign
R1536:Muc3a UTSW 5 137210081 missense unknown
R5076:Muc3a UTSW 5 137210540 missense probably damaging 0.99
R5356:Muc3a UTSW 5 137210564 missense probably benign 0.33
R6491:Muc3a UTSW 5 137212128 missense probably benign 0.00
R7524:Muc3a UTSW 5 137210563 missense probably benign 0.08
R8181:Muc3a UTSW 5 137210078 missense unknown
Predicted Primers PCR Primer
(F):5'- TCCAAGTGGGTTTCTGTCAAAC -3'
(R):5'- ACTTCCATGTTGCCTTGGAG -3'

Sequencing Primer
(F):5'- TGGGTTTCTGTCAAACAAAGAG -3'
(R):5'- AGGGTTACTAAGCAACCC -3'
Posted On2017-10-10