Incidental Mutation 'R6134:Vmn2r26'
ID 487273
Institutional Source Beutler Lab
Gene Symbol Vmn2r26
Ensembl Gene ENSMUSG00000096630
Gene Name vomeronasal 2, receptor 26
Synonyms V2r1b
MMRRC Submission 044281-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R6134 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 124001717-124038994 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 124038444 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 673 (I673T)
Ref Sequence ENSEMBL: ENSMUSP00000032238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032238]
AlphaFold Q6TAC4
Predicted Effect probably damaging
Transcript: ENSMUST00000032238
AA Change: I673T

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032238
Gene: ENSMUSG00000096630
AA Change: I673T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 82 471 1.5e-31 PFAM
Pfam:NCD3G 519 572 4.6e-25 PFAM
Pfam:7tm_3 603 840 1.5e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158682
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 94% (51/54)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal vomeronasal sensory neuron physiology and avnosmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik G A 11: 58,767,619 (GRCm39) E39K probably damaging Het
Afg3l2 G T 18: 67,554,329 (GRCm39) L458M probably damaging Het
Aktip T A 8: 91,856,388 (GRCm39) S30C probably damaging Het
Anxa10 G T 8: 62,530,977 (GRCm39) H78N probably damaging Het
Aoah C T 13: 21,095,293 (GRCm39) R196W probably damaging Het
Arl4c A T 1: 88,629,152 (GRCm39) W79R probably damaging Het
Brd2 A T 17: 34,332,669 (GRCm39) D178E probably benign Het
Cacna1e G A 1: 154,577,037 (GRCm39) P120L probably damaging Het
Cdh16 A T 8: 105,342,697 (GRCm39) M17K probably benign Het
Cdhr17 A T 5: 17,029,683 (GRCm39) D473V probably damaging Het
Chit1 A G 1: 134,071,798 (GRCm39) T103A possibly damaging Het
Clcn3 T C 8: 61,387,607 (GRCm39) Y214C probably damaging Het
Coch T A 12: 51,649,536 (GRCm39) D282E probably damaging Het
Col1a2 C A 6: 4,538,035 (GRCm39) S1181R unknown Het
Col6a2 T C 10: 76,442,978 (GRCm39) D506G probably damaging Het
Crx A T 7: 15,602,032 (GRCm39) Y215* probably null Het
Fasn A T 11: 120,713,012 (GRCm39) S58T probably benign Het
Fhip1a T C 3: 85,580,651 (GRCm39) E518G possibly damaging Het
Garem1 A T 18: 21,262,881 (GRCm39) D644E probably benign Het
H2-Q2 A C 17: 35,562,217 (GRCm39) T155P probably damaging Het
Insr A T 8: 3,242,572 (GRCm39) I49N probably damaging Het
Itgb4 C T 11: 115,874,983 (GRCm39) R447W probably benign Het
Lnpep A G 17: 17,773,454 (GRCm39) M639T probably benign Het
Lypd11 G A 7: 24,425,481 (GRCm39) A3V probably damaging Het
Map3k20 C T 2: 72,240,503 (GRCm39) S333F probably damaging Het
Miga2 A G 2: 30,261,229 (GRCm39) S175G probably benign Het
Muc3a A T 5: 137,244,579 (GRCm39) I191N probably damaging Het
Ncoa2 A G 1: 13,244,595 (GRCm39) V701A probably damaging Het
Nid2 T C 14: 19,828,851 (GRCm39) V565A probably damaging Het
Nova2 G A 7: 18,691,794 (GRCm39) A244T unknown Het
Numbl G C 7: 26,980,739 (GRCm39) A574P probably damaging Het
Oas3 A G 5: 120,907,113 (GRCm39) V508A unknown Het
Or8b36 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 37,937,836 (GRCm39) probably null Het
Otx1 A T 11: 21,949,406 (GRCm39) L24H probably damaging Het
Pcdhb21 T A 18: 37,647,461 (GRCm39) S197T probably benign Het
Pck2 T A 14: 55,781,419 (GRCm39) M180K probably damaging Het
Pgr T C 9: 8,900,740 (GRCm39) V91A possibly damaging Het
Phtf1 A T 3: 103,911,721 (GRCm39) M643L probably damaging Het
Prokr1 T C 6: 87,565,837 (GRCm39) T3A possibly damaging Het
Ptgs1 T C 2: 36,141,190 (GRCm39) Y546H probably damaging Het
Rasa1 A G 13: 85,374,745 (GRCm39) L742P probably benign Het
Rbbp6 T C 7: 122,596,534 (GRCm39) probably null Het
Rgs22 A G 15: 36,107,194 (GRCm39) L64P probably damaging Het
Rnf213 A T 11: 119,302,296 (GRCm39) I407F probably damaging Het
Rp1l1 C T 14: 64,267,545 (GRCm39) P1044S probably damaging Het
Scin G A 12: 40,110,578 (GRCm39) P690L probably damaging Het
Septin9 T C 11: 117,242,987 (GRCm39) L58P probably damaging Het
Slc1a7 A G 4: 107,869,633 (GRCm39) E566G probably damaging Het
Speer4f1 G A 5: 17,681,140 (GRCm39) R6Q probably benign Het
Tnxb A T 17: 34,890,986 (GRCm39) Y443F probably damaging Het
Trpv1 A G 11: 73,135,143 (GRCm39) I79V probably benign Het
Ttll6 C T 11: 96,030,568 (GRCm39) T245I possibly damaging Het
Zfp60 T C 7: 27,449,323 (GRCm39) F664L probably benign Het
Other mutations in Vmn2r26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Vmn2r26 APN 6 124,038,566 (GRCm39) missense probably benign 0.00
IGL01370:Vmn2r26 APN 6 124,038,715 (GRCm39) missense probably benign 0.08
IGL01603:Vmn2r26 APN 6 124,030,833 (GRCm39) missense probably damaging 1.00
IGL01651:Vmn2r26 APN 6 124,027,632 (GRCm39) missense probably benign 0.01
IGL02282:Vmn2r26 APN 6 124,038,584 (GRCm39) missense probably damaging 1.00
IGL02425:Vmn2r26 APN 6 124,038,777 (GRCm39) missense probably damaging 1.00
IGL02551:Vmn2r26 APN 6 124,003,100 (GRCm39) missense probably benign 0.11
IGL02690:Vmn2r26 APN 6 124,003,091 (GRCm39) missense probably benign 0.14
IGL03002:Vmn2r26 APN 6 124,016,754 (GRCm39) missense possibly damaging 0.78
IGL03270:Vmn2r26 APN 6 124,027,778 (GRCm39) missense probably benign 0.16
R0032:Vmn2r26 UTSW 6 124,016,858 (GRCm39) missense possibly damaging 0.72
R0052:Vmn2r26 UTSW 6 124,038,992 (GRCm39) makesense probably null
R0083:Vmn2r26 UTSW 6 124,030,940 (GRCm39) splice site probably null
R0682:Vmn2r26 UTSW 6 124,038,129 (GRCm39) missense probably damaging 0.97
R1061:Vmn2r26 UTSW 6 124,038,603 (GRCm39) missense probably benign 0.12
R1077:Vmn2r26 UTSW 6 124,030,872 (GRCm39) missense probably benign 0.00
R1263:Vmn2r26 UTSW 6 124,027,667 (GRCm39) missense probably benign
R1579:Vmn2r26 UTSW 6 124,016,706 (GRCm39) missense probably benign 0.00
R1741:Vmn2r26 UTSW 6 124,038,431 (GRCm39) missense probably damaging 1.00
R1834:Vmn2r26 UTSW 6 124,038,369 (GRCm39) missense possibly damaging 0.54
R1838:Vmn2r26 UTSW 6 124,001,730 (GRCm39) missense probably benign
R1956:Vmn2r26 UTSW 6 124,030,846 (GRCm39) missense probably damaging 1.00
R1996:Vmn2r26 UTSW 6 124,038,144 (GRCm39) missense probably damaging 1.00
R2140:Vmn2r26 UTSW 6 124,038,196 (GRCm39) missense probably benign 0.01
R2327:Vmn2r26 UTSW 6 124,016,708 (GRCm39) missense probably benign 0.07
R2417:Vmn2r26 UTSW 6 124,038,309 (GRCm39) missense probably damaging 1.00
R3930:Vmn2r26 UTSW 6 124,002,938 (GRCm39) missense probably benign
R4490:Vmn2r26 UTSW 6 124,027,697 (GRCm39) missense possibly damaging 0.47
R4629:Vmn2r26 UTSW 6 124,038,150 (GRCm39) missense possibly damaging 0.50
R4655:Vmn2r26 UTSW 6 124,038,375 (GRCm39) missense probably damaging 1.00
R4709:Vmn2r26 UTSW 6 124,030,924 (GRCm39) missense probably damaging 1.00
R4992:Vmn2r26 UTSW 6 124,003,070 (GRCm39) missense probably benign 0.00
R5297:Vmn2r26 UTSW 6 124,038,832 (GRCm39) missense probably damaging 1.00
R5482:Vmn2r26 UTSW 6 124,038,285 (GRCm39) missense possibly damaging 0.88
R5517:Vmn2r26 UTSW 6 124,027,676 (GRCm39) missense probably damaging 1.00
R5737:Vmn2r26 UTSW 6 124,016,408 (GRCm39) missense probably benign 0.00
R5739:Vmn2r26 UTSW 6 124,002,925 (GRCm39) missense probably benign 0.00
R5873:Vmn2r26 UTSW 6 124,038,633 (GRCm39) missense probably benign 0.01
R5907:Vmn2r26 UTSW 6 124,016,830 (GRCm39) missense probably benign 0.00
R6086:Vmn2r26 UTSW 6 124,016,519 (GRCm39) missense possibly damaging 0.48
R6391:Vmn2r26 UTSW 6 124,038,348 (GRCm39) missense probably damaging 1.00
R6428:Vmn2r26 UTSW 6 124,003,039 (GRCm39) missense probably benign 0.17
R6637:Vmn2r26 UTSW 6 124,038,650 (GRCm39) missense probably damaging 1.00
R6927:Vmn2r26 UTSW 6 124,016,057 (GRCm39) missense possibly damaging 0.93
R6953:Vmn2r26 UTSW 6 124,016,741 (GRCm39) missense probably benign 0.00
R7173:Vmn2r26 UTSW 6 124,038,255 (GRCm39) missense probably benign 0.16
R7206:Vmn2r26 UTSW 6 124,016,727 (GRCm39) missense probably benign 0.17
R7208:Vmn2r26 UTSW 6 124,038,948 (GRCm39) missense probably damaging 1.00
R7283:Vmn2r26 UTSW 6 124,002,914 (GRCm39) missense probably damaging 0.97
R7506:Vmn2r26 UTSW 6 124,016,700 (GRCm39) missense probably benign 0.00
R7672:Vmn2r26 UTSW 6 124,016,606 (GRCm39) missense probably benign 0.25
R7674:Vmn2r26 UTSW 6 124,016,321 (GRCm39) missense probably benign
R7696:Vmn2r26 UTSW 6 124,038,494 (GRCm39) missense possibly damaging 0.94
R7716:Vmn2r26 UTSW 6 124,038,704 (GRCm39) missense probably damaging 1.00
R7831:Vmn2r26 UTSW 6 124,016,758 (GRCm39) nonsense probably null
R8063:Vmn2r26 UTSW 6 124,001,914 (GRCm39) missense probably benign 0.00
R8331:Vmn2r26 UTSW 6 124,038,887 (GRCm39) missense probably benign 0.22
R8352:Vmn2r26 UTSW 6 124,016,577 (GRCm39) missense probably benign 0.09
R8445:Vmn2r26 UTSW 6 124,002,995 (GRCm39) missense probably damaging 0.97
R8452:Vmn2r26 UTSW 6 124,016,577 (GRCm39) missense probably benign 0.09
R8681:Vmn2r26 UTSW 6 124,001,877 (GRCm39) missense probably benign 0.00
R8914:Vmn2r26 UTSW 6 124,038,983 (GRCm39) missense probably benign
R9333:Vmn2r26 UTSW 6 124,003,009 (GRCm39) missense probably benign 0.13
R9351:Vmn2r26 UTSW 6 124,016,333 (GRCm39) missense probably benign
R9436:Vmn2r26 UTSW 6 124,002,826 (GRCm39) missense probably damaging 1.00
R9515:Vmn2r26 UTSW 6 124,038,137 (GRCm39) missense probably damaging 1.00
RF010:Vmn2r26 UTSW 6 124,016,448 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CACTGGGAACTGTTCTTGTCTC -3'
(R):5'- AGTGCATGTCAACATCAGGG -3'

Sequencing Primer
(F):5'- GCCTTTTCAGCTATGATTCTAGG -3'
(R):5'- CATCAGGGAAAGGGGGATATGTTCC -3'
Posted On 2017-10-10