Mutagenetix > Incidental Mutation

Incidental Mutation 'R6134:Vmn2r26'

487273

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r26

Ensembl Gene

ENSMUSG00000096630

Gene Name

vomeronasal 2, receptor 26

Synonyms

V2r1b

MMRRC Submission

044281-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.088) question?

Stock #

R6134 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

124024758-124062035 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 124061485 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 673 (I673T)

Ref Sequence

ENSEMBL: ENSMUSP00000032238 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032238]

AlphaFold

Q6TAC4

Predicted Effect

probably damaging
Transcript: ENSMUST00000032238
AA Change: I673T

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000032238
Gene: ENSMUSG00000096630
AA Change: I673T

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:ANF_receptor	82	471	1.5e-31	PFAM
Pfam:NCD3G	519	572	4.6e-25	PFAM
Pfam:7tm_3	603	840	1.5e-55	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158682

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

94% (51/54)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal vomeronasal sensory neuron physiology and avnosmia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810021J22Rik	G	A	11: 58,876,793	E39K	probably damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Aktip	T	A	8: 91,129,760	S30C	probably damaging	Het
Anxa10	G	T	8: 62,077,943	H78N	probably damaging	Het
Aoah	C	T	13: 20,911,123	R196W	probably damaging	Het
Arl4c	A	T	1: 88,701,430	W79R	probably damaging	Het
Brd2	A	T	17: 34,113,695	D178E	probably benign	Het
Cacna1e	G	A	1: 154,701,291	P120L	probably damaging	Het
Cdh16	A	T	8: 104,616,065	M17K	probably benign	Het
Chit1	A	G	1: 134,144,060	T103A	possibly damaging	Het
Clcn3	T	C	8: 60,934,573	Y214C	probably damaging	Het
Coch	T	A	12: 51,602,753	D282E	probably damaging	Het
Col1a2	C	A	6: 4,538,035	S1181R	unknown	Het
Col6a2	T	C	10: 76,607,144	D506G	probably damaging	Het
Crx	A	T	7: 15,868,107	Y215*	probably null	Het
Fam160a1	T	C	3: 85,673,344	E518G	possibly damaging	Het
Fasn	A	T	11: 120,822,186	S58T	probably benign	Het
Garem1	A	T	18: 21,129,824	D644E	probably benign	Het
Gm4763	G	A	7: 24,726,056	A3V	probably damaging	Het
H2-Q2	A	C	17: 35,343,241	T155P	probably damaging	Het
Insr	A	T	8: 3,192,572	I49N	probably damaging	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Lnpep	A	G	17: 17,553,192	M639T	probably benign	Het
Map3k20	C	T	2: 72,410,159	S333F	probably damaging	Het
Miga2	A	G	2: 30,371,217	S175G	probably benign	Het
Muc3a	A	T	5: 137,210,122	I191N	probably damaging	Het
Ncoa2	A	G	1: 13,174,371	V701A	probably damaging	Het
Nid2	T	C	14: 19,778,783	V565A	probably damaging	Het
Nova2	G	A	7: 18,957,869	A244T	unknown	Het
Numbl	G	C	7: 27,281,314	A574P	probably damaging	Het
Oas3	A	G	5: 120,769,048	V508A	unknown	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
Otx1	A	T	11: 21,999,406	L24H	probably damaging	Het
Pcdhb21	T	A	18: 37,514,408	S197T	probably benign	Het
Pck2	T	A	14: 55,543,962	M180K	probably damaging	Het
Pgr	T	C	9: 8,900,739	V91A	possibly damaging	Het
Phtf1	A	T	3: 104,004,405	M643L	probably damaging	Het
Prokr1	T	C	6: 87,588,855	T3A	possibly damaging	Het
Ptgs1	T	C	2: 36,251,178	Y546H	probably damaging	Het
Rasa1	A	G	13: 85,226,626	L742P	probably benign	Het
Rbbp6	T	C	7: 122,997,311		probably null	Het
Rgs22	A	G	15: 36,107,048	L64P	probably damaging	Het
Rnf213	A	T	11: 119,411,470	I407F	probably damaging	Het
Rp1l1	C	T	14: 64,030,096	P1044S	probably damaging	Het
RP24-388A6.3	A	T	5: 16,824,685	D473V	probably damaging	Het
Scin	G	A	12: 40,060,579	P690L	probably damaging	Het
Sept9	T	C	11: 117,352,161	L58P	probably damaging	Het
Slc1a7	A	G	4: 108,012,436	E566G	probably damaging	Het
Speer4f1	G	A	5: 17,476,142	R6Q	probably benign	Het
Tnxb	A	T	17: 34,672,012	Y443F	probably damaging	Het
Trpv1	A	G	11: 73,244,317	I79V	probably benign	Het
Ttll6	C	T	11: 96,139,742	T245I	possibly damaging	Het
Zfp60	T	C	7: 27,749,898	F664L	probably benign	Het

Other mutations in Vmn2r26

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01070:Vmn2r26	APN	6	124061607	missense	probably benign	0.00
IGL01370:Vmn2r26	APN	6	124061756	missense	probably benign	0.08
IGL01603:Vmn2r26	APN	6	124053874	missense	probably damaging	1.00
IGL01651:Vmn2r26	APN	6	124050673	missense	probably benign	0.01
IGL02282:Vmn2r26	APN	6	124061625	missense	probably damaging	1.00
IGL02425:Vmn2r26	APN	6	124061818	missense	probably damaging	1.00
IGL02551:Vmn2r26	APN	6	124026141	missense	probably benign	0.11
IGL02690:Vmn2r26	APN	6	124026132	missense	probably benign	0.14
IGL03002:Vmn2r26	APN	6	124039795	missense	possibly damaging	0.78
IGL03270:Vmn2r26	APN	6	124050819	missense	probably benign	0.16
R0032:Vmn2r26	UTSW	6	124039899	missense	possibly damaging	0.72
R0052:Vmn2r26	UTSW	6	124062033	makesense	probably null
R0083:Vmn2r26	UTSW	6	124053981	splice site	probably null
R0682:Vmn2r26	UTSW	6	124061170	missense	probably damaging	0.97
R1061:Vmn2r26	UTSW	6	124061644	missense	probably benign	0.12
R1077:Vmn2r26	UTSW	6	124053913	missense	probably benign	0.00
R1263:Vmn2r26	UTSW	6	124050708	missense	probably benign
R1579:Vmn2r26	UTSW	6	124039747	missense	probably benign	0.00
R1741:Vmn2r26	UTSW	6	124061472	missense	probably damaging	1.00
R1834:Vmn2r26	UTSW	6	124061410	missense	possibly damaging	0.54
R1838:Vmn2r26	UTSW	6	124024771	missense	probably benign
R1956:Vmn2r26	UTSW	6	124053887	missense	probably damaging	1.00
R1996:Vmn2r26	UTSW	6	124061185	missense	probably damaging	1.00
R2140:Vmn2r26	UTSW	6	124061237	missense	probably benign	0.01
R2327:Vmn2r26	UTSW	6	124039749	missense	probably benign	0.07
R2417:Vmn2r26	UTSW	6	124061350	missense	probably damaging	1.00
R3930:Vmn2r26	UTSW	6	124025979	missense	probably benign
R4490:Vmn2r26	UTSW	6	124050738	missense	possibly damaging	0.47
R4629:Vmn2r26	UTSW	6	124061191	missense	possibly damaging	0.50
R4655:Vmn2r26	UTSW	6	124061416	missense	probably damaging	1.00
R4709:Vmn2r26	UTSW	6	124053965	missense	probably damaging	1.00
R4992:Vmn2r26	UTSW	6	124026111	missense	probably benign	0.00
R5297:Vmn2r26	UTSW	6	124061873	missense	probably damaging	1.00
R5482:Vmn2r26	UTSW	6	124061326	missense	possibly damaging	0.88
R5517:Vmn2r26	UTSW	6	124050717	missense	probably damaging	1.00
R5737:Vmn2r26	UTSW	6	124039449	missense	probably benign	0.00
R5739:Vmn2r26	UTSW	6	124025966	missense	probably benign	0.00
R5873:Vmn2r26	UTSW	6	124061674	missense	probably benign	0.01
R5907:Vmn2r26	UTSW	6	124039871	missense	probably benign	0.00
R6086:Vmn2r26	UTSW	6	124039560	missense	possibly damaging	0.48
R6391:Vmn2r26	UTSW	6	124061389	missense	probably damaging	1.00
R6428:Vmn2r26	UTSW	6	124026080	missense	probably benign	0.17
R6637:Vmn2r26	UTSW	6	124061691	missense	probably damaging	1.00
R6927:Vmn2r26	UTSW	6	124039098	missense	possibly damaging	0.93
R6953:Vmn2r26	UTSW	6	124039782	missense	probably benign	0.00
R7173:Vmn2r26	UTSW	6	124061296	missense	probably benign	0.16
R7206:Vmn2r26	UTSW	6	124039768	missense	probably benign	0.17
R7208:Vmn2r26	UTSW	6	124061989	missense	probably damaging	1.00
R7283:Vmn2r26	UTSW	6	124025955	missense	probably damaging	0.97
R7506:Vmn2r26	UTSW	6	124039741	missense	probably benign	0.00
R7672:Vmn2r26	UTSW	6	124039647	missense	probably benign	0.25
R7674:Vmn2r26	UTSW	6	124039362	missense	probably benign
R7696:Vmn2r26	UTSW	6	124061535	missense	possibly damaging	0.94
R7716:Vmn2r26	UTSW	6	124061745	missense	probably damaging	1.00
R7831:Vmn2r26	UTSW	6	124039799	nonsense	probably null
R8063:Vmn2r26	UTSW	6	124024955	missense	probably benign	0.00
R8331:Vmn2r26	UTSW	6	124061928	missense	probably benign	0.22
R8352:Vmn2r26	UTSW	6	124039618	missense	probably benign	0.09
R8445:Vmn2r26	UTSW	6	124026036	missense	probably damaging	0.97
R8452:Vmn2r26	UTSW	6	124039618	missense	probably benign	0.09
R8681:Vmn2r26	UTSW	6	124024918	missense	probably benign	0.00
R8914:Vmn2r26	UTSW	6	124062024	missense	probably benign
R9333:Vmn2r26	UTSW	6	124026050	missense	probably benign	0.13
R9351:Vmn2r26	UTSW	6	124039374	missense	probably benign
R9436:Vmn2r26	UTSW	6	124025867	missense	probably damaging	1.00
R9515:Vmn2r26	UTSW	6	124061178	missense	probably damaging	1.00
RF010:Vmn2r26	UTSW	6	124039489	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- CACTGGGAACTGTTCTTGTCTC -3'
(R):5'- AGTGCATGTCAACATCAGGG -3'

Sequencing Primer
(F):5'- GCCTTTTCAGCTATGATTCTAGG -3'
(R):5'- CATCAGGGAAAGGGGGATATGTTCC -3'

Posted On

2017-10-10