Incidental Mutation 'R6134:Sept9'
ID487292
Institutional Source Beutler Lab
Gene Symbol Sept9
Ensembl Gene ENSMUSG00000059248
Gene Nameseptin 9
SynonymsPNUTL4, Msf, Sint1, SL3-3 integration site 1, MSF1
MMRRC Submission 044281-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6134 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location117199661-117362325 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 117352161 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 58 (L58P)
Ref Sequence ENSEMBL: ENSMUSP00000120382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019038] [ENSMUST00000093907] [ENSMUST00000100193] [ENSMUST00000106349] [ENSMUST00000106354] [ENSMUST00000127383] [ENSMUST00000153668]
Predicted Effect probably damaging
Transcript: ENSMUST00000019038
AA Change: L300P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019038
Gene: ENSMUSG00000059248
AA Change: L300P

DomainStartEndE-ValueType
Pfam:DUF258 265 379 5.3e-8 PFAM
Pfam:Septin 286 565 1.2e-112 PFAM
Pfam:GTP_EFTU 289 365 1.5e-5 PFAM
Pfam:AIG1 290 379 3.1e-7 PFAM
Pfam:MMR_HSR1 291 481 1.1e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000093907
AA Change: L307P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091435
Gene: ENSMUSG00000059248
AA Change: L307P

DomainStartEndE-ValueType
Pfam:Septin 293 572 1.6e-112 PFAM
Pfam:MMR_HSR1 298 444 3e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100193
AA Change: L58P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097767
Gene: ENSMUSG00000059248
AA Change: L58P

DomainStartEndE-ValueType
Pfam:DUF258 23 138 1.1e-8 PFAM
Pfam:Septin 44 323 3.4e-113 PFAM
Pfam:GTP_EFTU 47 123 6.2e-6 PFAM
Pfam:AIG1 48 138 2.4e-7 PFAM
Pfam:MMR_HSR1 49 194 4.6e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106349
AA Change: L58P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101956
Gene: ENSMUSG00000059248
AA Change: L58P

DomainStartEndE-ValueType
Pfam:DUF258 23 138 1.1e-8 PFAM
Pfam:Septin 44 323 3.4e-113 PFAM
Pfam:GTP_EFTU 47 123 6.2e-6 PFAM
Pfam:AIG1 48 138 2.4e-7 PFAM
Pfam:MMR_HSR1 49 194 4.6e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106354
AA Change: L289P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101961
Gene: ENSMUSG00000059248
AA Change: L289P

DomainStartEndE-ValueType
Pfam:DUF258 254 368 4.2e-8 PFAM
Pfam:Septin 275 554 3.4e-113 PFAM
Pfam:GTP_EFTU 278 354 3.7e-6 PFAM
Pfam:AIG1 279 368 1.9e-7 PFAM
Pfam:MMR_HSR1 280 378 7.6e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000127383
AA Change: L77P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120065
Gene: ENSMUSG00000059248
AA Change: L77P

DomainStartEndE-ValueType
Pfam:DUF258 43 158 1.2e-8 PFAM
Pfam:Septin 63 242 6.2e-79 PFAM
Pfam:GTP_EFTU 66 142 9.2e-7 PFAM
Pfam:AIG1 67 161 4.2e-8 PFAM
Pfam:MMR_HSR1 68 222 8.9e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134852
Predicted Effect probably damaging
Transcript: ENSMUST00000153668
AA Change: L58P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120382
Gene: ENSMUSG00000059248
AA Change: L58P

DomainStartEndE-ValueType
Pfam:DUF258 16 74 1.2e-7 PFAM
Pfam:Septin 44 74 4e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155331
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 94% (51/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a targeted allele exhibit embryonic lethality around E10 with generalized apoptotic degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik G A 11: 58,876,793 E39K probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Aktip T A 8: 91,129,760 S30C probably damaging Het
Anxa10 G T 8: 62,077,943 H78N probably damaging Het
Aoah C T 13: 20,911,123 R196W probably damaging Het
Arl4c A T 1: 88,701,430 W79R probably damaging Het
Brd2 A T 17: 34,113,695 D178E probably benign Het
Cacna1e G A 1: 154,701,291 P120L probably damaging Het
Cdh16 A T 8: 104,616,065 M17K probably benign Het
Chit1 A G 1: 134,144,060 T103A possibly damaging Het
Clcn3 T C 8: 60,934,573 Y214C probably damaging Het
Coch T A 12: 51,602,753 D282E probably damaging Het
Col1a2 C A 6: 4,538,035 S1181R unknown Het
Col6a2 T C 10: 76,607,144 D506G probably damaging Het
Crx A T 7: 15,868,107 Y215* probably null Het
Fam160a1 T C 3: 85,673,344 E518G possibly damaging Het
Fasn A T 11: 120,822,186 S58T probably benign Het
Garem1 A T 18: 21,129,824 D644E probably benign Het
Gm4763 G A 7: 24,726,056 A3V probably damaging Het
H2-Q2 A C 17: 35,343,241 T155P probably damaging Het
Insr A T 8: 3,192,572 I49N probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Lnpep A G 17: 17,553,192 M639T probably benign Het
Map3k20 C T 2: 72,410,159 S333F probably damaging Het
Miga2 A G 2: 30,371,217 S175G probably benign Het
Muc3a A T 5: 137,210,122 I191N probably damaging Het
Ncoa2 A G 1: 13,174,371 V701A probably damaging Het
Nid2 T C 14: 19,778,783 V565A probably damaging Het
Nova2 G A 7: 18,957,869 A244T unknown Het
Numbl G C 7: 27,281,314 A574P probably damaging Het
Oas3 A G 5: 120,769,048 V508A unknown Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Pcdhb21 T A 18: 37,514,408 S197T probably benign Het
Pck2 T A 14: 55,543,962 M180K probably damaging Het
Pgr T C 9: 8,900,739 V91A possibly damaging Het
Phtf1 A T 3: 104,004,405 M643L probably damaging Het
Prokr1 T C 6: 87,588,855 T3A possibly damaging Het
Ptgs1 T C 2: 36,251,178 Y546H probably damaging Het
Rasa1 A G 13: 85,226,626 L742P probably benign Het
Rbbp6 T C 7: 122,997,311 probably null Het
Rgs22 A G 15: 36,107,048 L64P probably damaging Het
Rnf213 A T 11: 119,411,470 I407F probably damaging Het
Rp1l1 C T 14: 64,030,096 P1044S probably damaging Het
RP24-388A6.3 A T 5: 16,824,685 D473V probably damaging Het
Scin G A 12: 40,060,579 P690L probably damaging Het
Slc1a7 A G 4: 108,012,436 E566G probably damaging Het
Speer4f1 G A 5: 17,476,142 R6Q probably benign Het
Tnxb A T 17: 34,672,012 Y443F probably damaging Het
Trpv1 A G 11: 73,244,317 I79V probably benign Het
Ttll6 C T 11: 96,139,742 T245I possibly damaging Het
Vmn2r26 T C 6: 124,061,485 I673T probably damaging Het
Zfp60 T C 7: 27,749,898 F664L probably benign Het
Other mutations in Sept9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Sept9 APN 11 117352184 missense probably damaging 1.00
IGL00230:Sept9 APN 11 117354804 unclassified probably benign
IGL01520:Sept9 APN 11 117352643 missense probably damaging 1.00
IGL01905:Sept9 APN 11 117218889 missense probably benign 0.07
IGL02502:Sept9 APN 11 117290662 missense probably damaging 1.00
R0325:Sept9 UTSW 11 117356632 missense probably damaging 0.99
R0825:Sept9 UTSW 11 117359460 missense probably damaging 1.00
R0845:Sept9 UTSW 11 117356325 unclassified probably benign
R1581:Sept9 UTSW 11 117290595 missense probably damaging 1.00
R1763:Sept9 UTSW 11 117290428 missense probably benign 0.04
R1848:Sept9 UTSW 11 117353083 unclassified probably benign
R2039:Sept9 UTSW 11 117351617 missense probably damaging 1.00
R2409:Sept9 UTSW 11 117360461 missense probably damaging 1.00
R2763:Sept9 UTSW 11 117326501 missense probably benign 0.05
R3545:Sept9 UTSW 11 117352673 missense probably damaging 1.00
R4062:Sept9 UTSW 11 117352265 missense probably damaging 1.00
R4601:Sept9 UTSW 11 117360484 missense probably damaging 1.00
R5139:Sept9 UTSW 11 117356685 missense possibly damaging 0.80
R5759:Sept9 UTSW 11 117352268 missense probably benign 0.15
R6062:Sept9 UTSW 11 117290800 missense possibly damaging 0.89
R6509:Sept9 UTSW 11 117290427 missense probably benign
R7562:Sept9 UTSW 11 117326511 critical splice donor site probably null
R7573:Sept9 UTSW 11 117199745 start gained probably benign
R7592:Sept9 UTSW 11 117290662 missense probably damaging 1.00
R7810:Sept9 UTSW 11 117359438 nonsense probably null
R8200:Sept9 UTSW 11 117232716 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCTGAGTTAAACCAGGCC -3'
(R):5'- AATTTTCCCACGGGGTCACG -3'

Sequencing Primer
(F):5'- TGAGTTAAACCAGGCCCCAAATC -3'
(R):5'- ACGTGACCTCTCTAGTGCTATG -3'
Posted On2017-10-10